FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639853_at:

>probe:Drosophila_2:1639853_at:565:493; Interrogation_Position=1001; Antisense; GTCAAGCTACAAGCGGATTCATCCG
>probe:Drosophila_2:1639853_at:395:219; Interrogation_Position=1052; Antisense; AAGTCCATTGGAACTCTGGCTCAGC
>probe:Drosophila_2:1639853_at:656:101; Interrogation_Position=1084; Antisense; AGCCAGGCCGAAAGTCAAGGCGGTC
>probe:Drosophila_2:1639853_at:584:225; Interrogation_Position=1099; Antisense; CAAGGCGGTCAAGAAACTGGTGGCT
>probe:Drosophila_2:1639853_at:602:581; Interrogation_Position=1119; Antisense; TGGCTGGAAAGGGAGCCTCCACACC
>probe:Drosophila_2:1639853_at:214:629; Interrogation_Position=1136; Antisense; TCCACACCGGATCTTTCCATAATGG
>probe:Drosophila_2:1639853_at:450:691; Interrogation_Position=1149; Antisense; TTTCCATAATGGAGGCCCAGGCCAC
>probe:Drosophila_2:1639853_at:299:69; Interrogation_Position=1167; Antisense; AGGCCACGTCGACTCCTCAAGGAGC
>probe:Drosophila_2:1639853_at:433:225; Interrogation_Position=1185; Antisense; AAGGAGCTACCAAGGCGAAGCGCAA
>probe:Drosophila_2:1639853_at:240:205; Interrogation_Position=1202; Antisense; AAGCGCAAGCGCAAAGTCTAGTTAT
>probe:Drosophila_2:1639853_at:92:545; Interrogation_Position=892; Antisense; GGATAATCCGCCAGCATCTAAAGCA
>probe:Drosophila_2:1639853_at:186:347; Interrogation_Position=905; Antisense; GCATCTAAAGCAGCTTCATCCGCTG
>probe:Drosophila_2:1639853_at:297:625; Interrogation_Position=928; Antisense; TGCCGCGCAGGCCATGCTGGAAACA
>probe:Drosophila_2:1639853_at:703:387; Interrogation_Position=947; Antisense; GAAACATCCCAGACAGCGATTCCTG

Paste this into a BLAST search page for me
GTCAAGCTACAAGCGGATTCATCCGAAGTCCATTGGAACTCTGGCTCAGCAGCCAGGCCGAAAGTCAAGGCGGTCCAAGGCGGTCAAGAAACTGGTGGCTTGGCTGGAAAGGGAGCCTCCACACCTCCACACCGGATCTTTCCATAATGGTTTCCATAATGGAGGCCCAGGCCACAGGCCACGTCGACTCCTCAAGGAGCAAGGAGCTACCAAGGCGAAGCGCAAAAGCGCAAGCGCAAAGTCTAGTTATGGATAATCCGCCAGCATCTAAAGCAGCATCTAAAGCAGCTTCATCCGCTGTGCCGCGCAGGCCATGCTGGAAACAGAAACATCCCAGACAGCGATTCCTG

Full Affymetrix probeset data:

Annotations for 1639853_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720