FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639855_at:

>probe:Drosophila_2:1639855_at:730:409; Interrogation_Position=469; Antisense; GACGCTACAGGTAATTCCACGACAA
>probe:Drosophila_2:1639855_at:611:177; Interrogation_Position=496; Antisense; AAACTGTACTTCTCATGTTACTTGG
>probe:Drosophila_2:1639855_at:567:489; Interrogation_Position=501; Antisense; GTACTTCTCATGTTACTTGGCTCAA
>probe:Drosophila_2:1639855_at:257:59; Interrogation_Position=510; Antisense; ATGTTACTTGGCTCAATGTGTCTCC
>probe:Drosophila_2:1639855_at:621:571; Interrogation_Position=519; Antisense; GGCTCAATGTGTCTCCCAAATGGAA
>probe:Drosophila_2:1639855_at:257:227; Interrogation_Position=537; Antisense; AATGGAACAATGGATCACTTGACTC
>probe:Drosophila_2:1639855_at:245:543; Interrogation_Position=548; Antisense; GGATCACTTGACTCCAAAAATTGGG
>probe:Drosophila_2:1639855_at:550:305; Interrogation_Position=560; Antisense; TCCAAAAATTGGGTACTTTCTTCAG
>probe:Drosophila_2:1639855_at:410:533; Interrogation_Position=571; Antisense; GGTACTTTCTTCAGGTTTCTAAGCA
>probe:Drosophila_2:1639855_at:427:479; Interrogation_Position=585; Antisense; GTTTCTAAGCATATGATGGCGGTCT
>probe:Drosophila_2:1639855_at:172:23; Interrogation_Position=595; Antisense; ATATGATGGCGGTCTTGCCTGTAAC
>probe:Drosophila_2:1639855_at:647:531; Interrogation_Position=605; Antisense; GGTCTTGCCTGTAACCGTCAAAATT
>probe:Drosophila_2:1639855_at:271:491; Interrogation_Position=615; Antisense; GTAACCGTCAAAATTAATCAATCCT
>probe:Drosophila_2:1639855_at:393:653; Interrogation_Position=629; Antisense; TAATCAATCCTTATCAAAACGTATA

Paste this into a BLAST search page for me
GACGCTACAGGTAATTCCACGACAAAAACTGTACTTCTCATGTTACTTGGGTACTTCTCATGTTACTTGGCTCAAATGTTACTTGGCTCAATGTGTCTCCGGCTCAATGTGTCTCCCAAATGGAAAATGGAACAATGGATCACTTGACTCGGATCACTTGACTCCAAAAATTGGGTCCAAAAATTGGGTACTTTCTTCAGGGTACTTTCTTCAGGTTTCTAAGCAGTTTCTAAGCATATGATGGCGGTCTATATGATGGCGGTCTTGCCTGTAACGGTCTTGCCTGTAACCGTCAAAATTGTAACCGTCAAAATTAATCAATCCTTAATCAATCCTTATCAAAACGTATA

Full Affymetrix probeset data:

Annotations for 1639855_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720