FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639856_at:

>probe:Drosophila_2:1639856_at:264:129; Interrogation_Position=199; Antisense; ACCTTCATCCAAATCGCCAATCAGA
>probe:Drosophila_2:1639856_at:385:633; Interrogation_Position=250; Antisense; TCGCCCACCCAAATACGCAGAAAAT
>probe:Drosophila_2:1639856_at:620:375; Interrogation_Position=285; Antisense; GAAGAGCGCCTATCTGTGTTACAAA
>probe:Drosophila_2:1639856_at:155:449; Interrogation_Position=322; Antisense; GATCGACTATTTCTGATACCCGAGA
>probe:Drosophila_2:1639856_at:256:201; Interrogation_Position=355; Antisense; AACGCCATCGCTGAGTTCGTAGAAA
>probe:Drosophila_2:1639856_at:709:163; Interrogation_Position=389; Antisense; AAATCGGACGTTCCAATCTATCCAC
>probe:Drosophila_2:1639856_at:136:127; Interrogation_Position=412; Antisense; ACCATTTCAAGTGGAACCCCAGCTA
>probe:Drosophila_2:1639856_at:502:201; Interrogation_Position=426; Antisense; AACCCCAGCTATCGTGCAGCAAAAT
>probe:Drosophila_2:1639856_at:711:489; Interrogation_Position=457; Antisense; GTACACTCAGAGGAAGACACTTCGC
>probe:Drosophila_2:1639856_at:237:397; Interrogation_Position=472; Antisense; GACACTTCGCCCATGGATATATTCC
>probe:Drosophila_2:1639856_at:294:459; Interrogation_Position=487; Antisense; GATATATTCCTGAATCAGATCCGTA
>probe:Drosophila_2:1639856_at:694:697; Interrogation_Position=527; Antisense; TTAATTCGGAGTTCTTTAGGATGGA
>probe:Drosophila_2:1639856_at:121:367; Interrogation_Position=553; Antisense; GAATCGTTACAGCAATTCGAACAGA
>probe:Drosophila_2:1639856_at:501:149; Interrogation_Position=602; Antisense; ACATAGCCAAGCTCATCGATGGTTA

Paste this into a BLAST search page for me
ACCTTCATCCAAATCGCCAATCAGATCGCCCACCCAAATACGCAGAAAATGAAGAGCGCCTATCTGTGTTACAAAGATCGACTATTTCTGATACCCGAGAAACGCCATCGCTGAGTTCGTAGAAAAAATCGGACGTTCCAATCTATCCACACCATTTCAAGTGGAACCCCAGCTAAACCCCAGCTATCGTGCAGCAAAATGTACACTCAGAGGAAGACACTTCGCGACACTTCGCCCATGGATATATTCCGATATATTCCTGAATCAGATCCGTATTAATTCGGAGTTCTTTAGGATGGAGAATCGTTACAGCAATTCGAACAGAACATAGCCAAGCTCATCGATGGTTA

Full Affymetrix probeset data:

Annotations for 1639856_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720