FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639857_at:

>probe:Drosophila_2:1639857_at:649:45; Interrogation_Position=131; Antisense; ATCCGCCTGCCTACTTGGAACTGGA
>probe:Drosophila_2:1639857_at:362:413; Interrogation_Position=171; Antisense; GACCGGCGTGGAATACTTTAAGGCA
>probe:Drosophila_2:1639857_at:415:121; Interrogation_Position=218; Antisense; AGCGATAATACCCTCACGGAACTGA
>probe:Drosophila_2:1639857_at:497:565; Interrogation_Position=244; Antisense; GGCAAAACGTGGCTACACCTACGAT
>probe:Drosophila_2:1639857_at:55:185; Interrogation_Position=288; Antisense; AAAAGTGCCTTCCAGACTATGCCAA
>probe:Drosophila_2:1639857_at:210:391; Interrogation_Position=319; Antisense; GAAAGCCTTTTTCACCGAACACCTG
>probe:Drosophila_2:1639857_at:134:301; Interrogation_Position=380; Antisense; TCCGGTTACTTTGATGTTCGCGACA
>probe:Drosophila_2:1639857_at:83:143; Interrogation_Position=414; Antisense; ACTGGTTGCGCATTAAGGTTGTCAA
>probe:Drosophila_2:1639857_at:141:687; Interrogation_Position=454; Antisense; TATACCAGCTGGCATATATCACCGC
>probe:Drosophila_2:1639857_at:427:649; Interrogation_Position=472; Antisense; TCACCGCTTTACTTTGGATACCAAT
>probe:Drosophila_2:1639857_at:7:265; Interrogation_Position=505; Antisense; CAGAACTCGTCGCTATTTTGTGGGC
>probe:Drosophila_2:1639857_at:697:15; Interrogation_Position=519; Antisense; ATTTTGTGGGCGAACCTGTCTGGGC
>probe:Drosophila_2:1639857_at:211:229; Interrogation_Position=568; Antisense; AATGGACTGTCGCAAATCGTACATC
>probe:Drosophila_2:1639857_at:215:43; Interrogation_Position=583; Antisense; ATCGTACATCAAGCATCAGTCGGAA

Paste this into a BLAST search page for me
ATCCGCCTGCCTACTTGGAACTGGAGACCGGCGTGGAATACTTTAAGGCAAGCGATAATACCCTCACGGAACTGAGGCAAAACGTGGCTACACCTACGATAAAAGTGCCTTCCAGACTATGCCAAGAAAGCCTTTTTCACCGAACACCTGTCCGGTTACTTTGATGTTCGCGACAACTGGTTGCGCATTAAGGTTGTCAATATACCAGCTGGCATATATCACCGCTCACCGCTTTACTTTGGATACCAATCAGAACTCGTCGCTATTTTGTGGGCATTTTGTGGGCGAACCTGTCTGGGCAATGGACTGTCGCAAATCGTACATCATCGTACATCAAGCATCAGTCGGAA

Full Affymetrix probeset data:

Annotations for 1639857_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720