Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639862_at:

>probe:Drosophila_2:1639862_at:499:225; Interrogation_Position=2471; Antisense; AAGGACTCCGCATACGTAAATATGG
>probe:Drosophila_2:1639862_at:299:365; Interrogation_Position=2495; Antisense; GAATATTCATCTTGTAGGACTCGCA
>probe:Drosophila_2:1639862_at:421:119; Interrogation_Position=2566; Antisense; AGCGCGGGATTTTTTGGGATCCATC
>probe:Drosophila_2:1639862_at:167:449; Interrogation_Position=2583; Antisense; GATCCATCCTGGGAACTATGTGCAT
>probe:Drosophila_2:1639862_at:441:529; Interrogation_Position=2645; Antisense; GGGTCACCAAGCTGATTTGTTTTAT
>probe:Drosophila_2:1639862_at:281:251; Interrogation_Position=2775; Antisense; CAAGAAGCTGGCCTAGATTTAGTTT
>probe:Drosophila_2:1639862_at:47:459; Interrogation_Position=2790; Antisense; GATTTAGTTTTAGTTGACCTCCTAT
>probe:Drosophila_2:1639862_at:582:609; Interrogation_Position=2804; Antisense; TGACCTCCTATTTTCCCGAAACTCA
>probe:Drosophila_2:1639862_at:202:651; Interrogation_Position=2826; Antisense; TCACGTTTGGTTATACGCCCCTGAT
>probe:Drosophila_2:1639862_at:384:565; Interrogation_Position=2875; Antisense; GGAATATCACTTACCAATTACTCAT
>probe:Drosophila_2:1639862_at:178:23; Interrogation_Position=2919; Antisense; ATATCACACATGCATTCGTAGACTG
>probe:Drosophila_2:1639862_at:177:707; Interrogation_Position=2994; Antisense; TTACTAACCAATATCCGACATTCGA
>probe:Drosophila_2:1639862_at:547:401; Interrogation_Position=3010; Antisense; GACATTCGATTTGTACGCGGACGCA
>probe:Drosophila_2:1639862_at:491:289; Interrogation_Position=3027; Antisense; CGGACGCATACGCTGAATACAATAA

Paste this into a BLAST search page for me
AAGGACTCCGCATACGTAAATATGGGAATATTCATCTTGTAGGACTCGCAAGCGCGGGATTTTTTGGGATCCATCGATCCATCCTGGGAACTATGTGCATGGGTCACCAAGCTGATTTGTTTTATCAAGAAGCTGGCCTAGATTTAGTTTGATTTAGTTTTAGTTGACCTCCTATTGACCTCCTATTTTCCCGAAACTCATCACGTTTGGTTATACGCCCCTGATGGAATATCACTTACCAATTACTCATATATCACACATGCATTCGTAGACTGTTACTAACCAATATCCGACATTCGAGACATTCGATTTGTACGCGGACGCACGGACGCATACGCTGAATACAATAA

Full Affymetrix probeset data:

Annotations for 1639862_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime