Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639863_at:

>probe:Drosophila_2:1639863_at:625:311; Interrogation_Position=1013; Antisense; GCCACAATGAGTCAGTCGTGTCCAA
>probe:Drosophila_2:1639863_at:483:607; Interrogation_Position=1040; Antisense; TGAGGACTAGCCAATTCACCTTCAT
>probe:Drosophila_2:1639863_at:387:495; Interrogation_Position=1069; Antisense; GTCACGGCTCACAAGGTGCTATCAA
>probe:Drosophila_2:1639863_at:710:613; Interrogation_Position=1133; Antisense; TGAAGTACGCGGAGGATCACCAGTT
>probe:Drosophila_2:1639863_at:154:265; Interrogation_Position=1153; Antisense; CAGTTCGCCAACTACGGAATCGGAG
>probe:Drosophila_2:1639863_at:726:669; Interrogation_Position=1207; Antisense; TACCAGACGACCCTTTCGGATGTTG
>probe:Drosophila_2:1639863_at:382:581; Interrogation_Position=1230; Antisense; TGCCCAAGGTGGAGGTACTGCGTTT
>probe:Drosophila_2:1639863_at:23:327; Interrogation_Position=1249; Antisense; GCGTTTCCGCAGCTAAGAACTCTAT
>probe:Drosophila_2:1639863_at:625:351; Interrogation_Position=1291; Antisense; GCAGCTGCATTTTGGCACAATCTCC
>probe:Drosophila_2:1639863_at:706:385; Interrogation_Position=1340; Antisense; GAACACAGCATGGTGCGTGTCCTAT
>probe:Drosophila_2:1639863_at:700:515; Interrogation_Position=1356; Antisense; GTGTCCTATAATCGCCGGTTCGAAG
>probe:Drosophila_2:1639863_at:62:655; Interrogation_Position=1413; Antisense; TCAATCTGATCGTCGTCCCTGTGAA
>probe:Drosophila_2:1639863_at:164:149; Interrogation_Position=1437; Antisense; ACTTTGGGATGATTCGTTGGCCACC
>probe:Drosophila_2:1639863_at:681:465; Interrogation_Position=1452; Antisense; GTTGGCCACCTATGCGCAGATTTTG

Paste this into a BLAST search page for me
GCCACAATGAGTCAGTCGTGTCCAATGAGGACTAGCCAATTCACCTTCATGTCACGGCTCACAAGGTGCTATCAATGAAGTACGCGGAGGATCACCAGTTCAGTTCGCCAACTACGGAATCGGAGTACCAGACGACCCTTTCGGATGTTGTGCCCAAGGTGGAGGTACTGCGTTTGCGTTTCCGCAGCTAAGAACTCTATGCAGCTGCATTTTGGCACAATCTCCGAACACAGCATGGTGCGTGTCCTATGTGTCCTATAATCGCCGGTTCGAAGTCAATCTGATCGTCGTCCCTGTGAAACTTTGGGATGATTCGTTGGCCACCGTTGGCCACCTATGCGCAGATTTTG

Full Affymetrix probeset data:

Annotations for 1639863_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime