FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639867_at:

>probe:Drosophila_2:1639867_at:159:587; Interrogation_Position=1003; Antisense; TGGACGTCAATCTGCGGTCGGCCAC
>probe:Drosophila_2:1639867_at:532:359; Interrogation_Position=1087; Antisense; GCAACCTCAAGCTGAAGGCAGCCGT
>probe:Drosophila_2:1639867_at:657:547; Interrogation_Position=1127; Antisense; GGATGAGTGCCAGAACGTCTACAGC
>probe:Drosophila_2:1639867_at:62:113; Interrogation_Position=1149; Antisense; AGCAGCCAGGACATTCTCCTCGAGG
>probe:Drosophila_2:1639867_at:562:715; Interrogation_Position=1162; Antisense; TTCTCCTCGAGGACACACAGATGTG
>probe:Drosophila_2:1639867_at:41:227; Interrogation_Position=1197; Antisense; AAGGAAGGCGTCGACTCCTGTCGCG
>probe:Drosophila_2:1639867_at:425:317; Interrogation_Position=1284; Antisense; GCCGGCGTCGTGTCATTTGGACCGA
>probe:Drosophila_2:1639867_at:328:305; Interrogation_Position=1324; Antisense; CCGGATGGCCAGGAGTTTACACGCT
>probe:Drosophila_2:1639867_at:84:135; Interrogation_Position=1344; Antisense; ACGCTGGTGGGCAAGTACGTTGATT
>probe:Drosophila_2:1639867_at:126:557; Interrogation_Position=866; Antisense; GGACGTGCCCGTGGAGCGTACTATA
>probe:Drosophila_2:1639867_at:343:673; Interrogation_Position=903; Antisense; TATATACCGGCCTCCAAGAACCAGG
>probe:Drosophila_2:1639867_at:155:109; Interrogation_Position=919; Antisense; AGAACCAGGTCAACGACATAGCCCT
>probe:Drosophila_2:1639867_at:513:519; Interrogation_Position=963; Antisense; GTGGAGTACACCGACTTTGTGCGAC
>probe:Drosophila_2:1639867_at:216:273; Interrogation_Position=989; Antisense; CATTTGCCTGCCTCTGGACGTCAAT

Paste this into a BLAST search page for me
TGGACGTCAATCTGCGGTCGGCCACGCAACCTCAAGCTGAAGGCAGCCGTGGATGAGTGCCAGAACGTCTACAGCAGCAGCCAGGACATTCTCCTCGAGGTTCTCCTCGAGGACACACAGATGTGAAGGAAGGCGTCGACTCCTGTCGCGGCCGGCGTCGTGTCATTTGGACCGACCGGATGGCCAGGAGTTTACACGCTACGCTGGTGGGCAAGTACGTTGATTGGACGTGCCCGTGGAGCGTACTATATATATACCGGCCTCCAAGAACCAGGAGAACCAGGTCAACGACATAGCCCTGTGGAGTACACCGACTTTGTGCGACCATTTGCCTGCCTCTGGACGTCAAT

Full Affymetrix probeset data:

Annotations for 1639867_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720