FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639868_at:

>probe:Drosophila_2:1639868_at:218:223; Interrogation_Position=305; Antisense; AAGGGCAAGATACCGGAGCACCTCT
>probe:Drosophila_2:1639868_at:175:217; Interrogation_Position=335; Antisense; AAGTACTTCGTTGACCAGAGCCGCG
>probe:Drosophila_2:1639868_at:568:427; Interrogation_Position=365; Antisense; GAGTTCCTCGAATGGCAGCACATGT
>probe:Drosophila_2:1639868_at:327:587; Interrogation_Position=432; Antisense; TGGAGCCGCTTCTGACAGGACGCAC
>probe:Drosophila_2:1639868_at:613:165; Interrogation_Position=471; Antisense; AAATCGAGACGTTCCGCATGCAGAT
>probe:Drosophila_2:1639868_at:353:331; Interrogation_Position=572; Antisense; GCGGACATCTTTGCAGCCTGTGAAA
>probe:Drosophila_2:1639868_at:575:135; Interrogation_Position=621; Antisense; ACGATGTCAGGATCAAGTACCCCAA
>probe:Drosophila_2:1639868_at:178:89; Interrogation_Position=636; Antisense; AGTACCCCAAGATCAGGGCGTGGCT
>probe:Drosophila_2:1639868_at:270:265; Interrogation_Position=674; Antisense; CAGAGCTGCAATCCGTACTACGATG
>probe:Drosophila_2:1639868_at:85:429; Interrogation_Position=707; Antisense; GAGTTCGTCTACAAAATCTCCGGAA
>probe:Drosophila_2:1639868_at:630:381; Interrogation_Position=729; Antisense; GAACGGGTCCACAGGCCAAGCTATA
>probe:Drosophila_2:1639868_at:591:627; Interrogation_Position=757; Antisense; TCCAACGTTCACAAAGCCATTCTGT
>probe:Drosophila_2:1639868_at:553:453; Interrogation_Position=787; Antisense; GATCATTATCATTGCTGGGTACTTA
>probe:Drosophila_2:1639868_at:234:419; Interrogation_Position=845; Antisense; GAGCTTGTCGCTGGTTTATACTTGT

Paste this into a BLAST search page for me
AAGGGCAAGATACCGGAGCACCTCTAAGTACTTCGTTGACCAGAGCCGCGGAGTTCCTCGAATGGCAGCACATGTTGGAGCCGCTTCTGACAGGACGCACAAATCGAGACGTTCCGCATGCAGATGCGGACATCTTTGCAGCCTGTGAAAACGATGTCAGGATCAAGTACCCCAAAGTACCCCAAGATCAGGGCGTGGCTCAGAGCTGCAATCCGTACTACGATGGAGTTCGTCTACAAAATCTCCGGAAGAACGGGTCCACAGGCCAAGCTATATCCAACGTTCACAAAGCCATTCTGTGATCATTATCATTGCTGGGTACTTAGAGCTTGTCGCTGGTTTATACTTGT

Full Affymetrix probeset data:

Annotations for 1639868_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720