FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639870_at:

>probe:Drosophila_2:1639870_at:500:315; Interrogation_Position=428; Antisense; GCCTTCTCCTACATATGCAGTATTG
>probe:Drosophila_2:1639870_at:468:125; Interrogation_Position=465; Antisense; AGCCGGCGCATCCTTACGAGGAGTA
>probe:Drosophila_2:1639870_at:454:7; Interrogation_Position=489; Antisense; ATTCCCATTGGAAGGAGGCGCCACT
>probe:Drosophila_2:1639870_at:424:617; Interrogation_Position=513; Antisense; TGCACTCCGTGATCGATGTGGTCAA
>probe:Drosophila_2:1639870_at:310:591; Interrogation_Position=531; Antisense; TGGTCAACGCATTCGTAACCGACGA
>probe:Drosophila_2:1639870_at:569:499; Interrogation_Position=604; Antisense; GTCGGCCATAACTACATTGATCACC
>probe:Drosophila_2:1639870_at:702:33; Interrogation_Position=623; Antisense; ATCACCAGTGATCGGTTCGACATCA
>probe:Drosophila_2:1639870_at:518:83; Interrogation_Position=662; Antisense; AGTGAAATAATTTCCCTCGTGCCCG
>probe:Drosophila_2:1639870_at:642:725; Interrogation_Position=770; Antisense; TTGTGTGGTCATCCGTTTCCCAATA
>probe:Drosophila_2:1639870_at:663:689; Interrogation_Position=785; Antisense; TTTCCCAATACCGATACTATACCGT
>probe:Drosophila_2:1639870_at:699:561; Interrogation_Position=826; Antisense; GGAATCCGAGGACTTTAGCCAGGCC
>probe:Drosophila_2:1639870_at:306:675; Interrogation_Position=841; Antisense; TAGCCAGGCCAACGATGCAGAGATC
>probe:Drosophila_2:1639870_at:459:215; Interrogation_Position=900; Antisense; AAGATCTTCCCACGGACTGGAGGCC
>probe:Drosophila_2:1639870_at:162:549; Interrogation_Position=918; Antisense; GGAGGCCAAGTGAGCATGACCAAAT

Paste this into a BLAST search page for me
GCCTTCTCCTACATATGCAGTATTGAGCCGGCGCATCCTTACGAGGAGTAATTCCCATTGGAAGGAGGCGCCACTTGCACTCCGTGATCGATGTGGTCAATGGTCAACGCATTCGTAACCGACGAGTCGGCCATAACTACATTGATCACCATCACCAGTGATCGGTTCGACATCAAGTGAAATAATTTCCCTCGTGCCCGTTGTGTGGTCATCCGTTTCCCAATATTTCCCAATACCGATACTATACCGTGGAATCCGAGGACTTTAGCCAGGCCTAGCCAGGCCAACGATGCAGAGATCAAGATCTTCCCACGGACTGGAGGCCGGAGGCCAAGTGAGCATGACCAAAT

Full Affymetrix probeset data:

Annotations for 1639870_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720