Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639872_at:

>probe:Drosophila_2:1639872_at:219:157; Interrogation_Position=46; Antisense; ACACGGGAGCTGCAGCCTGGACCCT
>probe:Drosophila_2:1639872_at:611:527; Interrogation_Position=50; Antisense; GGGAGCTGCAGCCTGGACCCTACAT
>probe:Drosophila_2:1639872_at:200:419; Interrogation_Position=52; Antisense; GAGCTGCAGCCTGGACCCTACATAT
>probe:Drosophila_2:1639872_at:181:193; Interrogation_Position=573; Antisense; AACTCCGCTGCGTGTACGTACCCAA
>probe:Drosophila_2:1639872_at:218:335; Interrogation_Position=579; Antisense; GCTGCGTGTACGTACCCAAACTAAT
>probe:Drosophila_2:1639872_at:238:593; Interrogation_Position=581; Antisense; TGCGTGTACGTACCCAAACTAATTA
>probe:Drosophila_2:1639872_at:664:125; Interrogation_Position=59; Antisense; AGCCTGGACCCTACATATCCAATGT
>probe:Drosophila_2:1639872_at:52:313; Interrogation_Position=616; Antisense; GAAAAGAAACACTCAATGCGACCGA
>probe:Drosophila_2:1639872_at:615:211; Interrogation_Position=619; Antisense; AAGAAACACTCAATGCGACCGAAAT
>probe:Drosophila_2:1639872_at:419:389; Interrogation_Position=621; Antisense; GAAACACTCAATGCGACCGAAATAA
>probe:Drosophila_2:1639872_at:410:555; Interrogation_Position=64; Antisense; GGACCCTACATATCCAATGTTCAGA
>probe:Drosophila_2:1639872_at:539:411; Interrogation_Position=65; Antisense; GACCCTACATATCCAATGTTCAGAA
>probe:Drosophila_2:1639872_at:500:149; Interrogation_Position=71; Antisense; ACATATCCAATGTTCAGAATTTAAA
>probe:Drosophila_2:1639872_at:687:57; Interrogation_Position=88; Antisense; AATTTAAATGTTGTGTTTGGTCGAG

Paste this into a BLAST search page for me
ACACGGGAGCTGCAGCCTGGACCCTGGGAGCTGCAGCCTGGACCCTACATGAGCTGCAGCCTGGACCCTACATATAACTCCGCTGCGTGTACGTACCCAAGCTGCGTGTACGTACCCAAACTAATTGCGTGTACGTACCCAAACTAATTAAGCCTGGACCCTACATATCCAATGTGAAAAGAAACACTCAATGCGACCGAAAGAAACACTCAATGCGACCGAAATGAAACACTCAATGCGACCGAAATAAGGACCCTACATATCCAATGTTCAGAGACCCTACATATCCAATGTTCAGAAACATATCCAATGTTCAGAATTTAAAAATTTAAATGTTGTGTTTGGTCGAG

Full Affymetrix probeset data:

Annotations for 1639872_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime