Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639873_at:

>probe:Drosophila_2:1639873_at:580:513; Interrogation_Position=2159; Antisense; GGTAGGAACCCAGGAGGAACAAATG
>probe:Drosophila_2:1639873_at:38:269; Interrogation_Position=2217; Antisense; CAGGAAACTGAGCAGGCGGAAACTC
>probe:Drosophila_2:1639873_at:265:513; Interrogation_Position=2259; Antisense; GTGTAGGCCAAGTGAGATACCGAAA
>probe:Drosophila_2:1639873_at:358:457; Interrogation_Position=2274; Antisense; GATACCGAAAATCAATATGCTCAGG
>probe:Drosophila_2:1639873_at:492:559; Interrogation_Position=2297; Antisense; GGAAATCAATTTTACGCGCGCTTCG
>probe:Drosophila_2:1639873_at:486:15; Interrogation_Position=2305; Antisense; ATTTTACGCGCGCTTCGTATCCAAC
>probe:Drosophila_2:1639873_at:618:343; Interrogation_Position=2316; Antisense; GCTTCGTATCCAACTTCGAACCAAC
>probe:Drosophila_2:1639873_at:458:253; Interrogation_Position=2326; Antisense; CAACTTCGAACCAACCACAACAATA
>probe:Drosophila_2:1639873_at:370:239; Interrogation_Position=2347; Antisense; AATAACAATGCGCACGTGAGGACGA
>probe:Drosophila_2:1639873_at:142:257; Interrogation_Position=2359; Antisense; CACGTGAGGACGAGGGCTGCTCCCT
>probe:Drosophila_2:1639873_at:254:279; Interrogation_Position=2460; Antisense; CTCGCCTGGGAGAGTCCTTTTGGTC
>probe:Drosophila_2:1639873_at:525:423; Interrogation_Position=2469; Antisense; GAGAGTCCTTTTGGTCCTGTTTCTT
>probe:Drosophila_2:1639873_at:559:627; Interrogation_Position=2483; Antisense; TCCTGTTTCTTTGACTGCGATTTTA
>probe:Drosophila_2:1639873_at:386:139; Interrogation_Position=2496; Antisense; ACTGCGATTTTATTCGTTCGGTGGC

Paste this into a BLAST search page for me
GGTAGGAACCCAGGAGGAACAAATGCAGGAAACTGAGCAGGCGGAAACTCGTGTAGGCCAAGTGAGATACCGAAAGATACCGAAAATCAATATGCTCAGGGGAAATCAATTTTACGCGCGCTTCGATTTTACGCGCGCTTCGTATCCAACGCTTCGTATCCAACTTCGAACCAACCAACTTCGAACCAACCACAACAATAAATAACAATGCGCACGTGAGGACGACACGTGAGGACGAGGGCTGCTCCCTCTCGCCTGGGAGAGTCCTTTTGGTCGAGAGTCCTTTTGGTCCTGTTTCTTTCCTGTTTCTTTGACTGCGATTTTAACTGCGATTTTATTCGTTCGGTGGC

Full Affymetrix probeset data:

Annotations for 1639873_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime