FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639874_at:

>probe:Drosophila_2:1639874_at:283:285; Interrogation_Position=461; Antisense; CTGTCTGGTGCTGGCCATGATTGAA
>probe:Drosophila_2:1639874_at:262:581; Interrogation_Position=502; Antisense; TGGCCACCATTAATGCAGCCGACAA
>probe:Drosophila_2:1639874_at:70:541; Interrogation_Position=535; Antisense; GGATAGTCATCAAGCCGCAGCGGGC
>probe:Drosophila_2:1639874_at:265:439; Interrogation_Position=567; Antisense; GAGGCCATACTGGAGACTATTGATC
>probe:Drosophila_2:1639874_at:59:607; Interrogation_Position=587; Antisense; TGATCCGAAGAGAGCGTCATCCACT
>probe:Drosophila_2:1639874_at:517:495; Interrogation_Position=602; Antisense; GTCATCCACTCAAGATTTCGCACTG
>probe:Drosophila_2:1639874_at:75:239; Interrogation_Position=673; Antisense; CAAATTTACTTCAGGACATTCCGGT
>probe:Drosophila_2:1639874_at:198:431; Interrogation_Position=701; Antisense; GAGTCACGAGCGAGATTCCAAACAG
>probe:Drosophila_2:1639874_at:35:155; Interrogation_Position=722; Antisense; ACAGAAGCCATTTTATTCCCTCTTG
>probe:Drosophila_2:1639874_at:460:299; Interrogation_Position=763; Antisense; CCCAGATGTTCTAGTGTTGCCCAAA
>probe:Drosophila_2:1639874_at:680:699; Interrogation_Position=803; Antisense; TTTTCATTCAATCTTTCGTTCTCAA
>probe:Drosophila_2:1639874_at:74:639; Interrogation_Position=818; Antisense; TCGTTCTCAACAATCACTCATCAAA
>probe:Drosophila_2:1639874_at:167:471; Interrogation_Position=854; Antisense; GTACTAGTTTTCACCGTTCATTTCA
>probe:Drosophila_2:1639874_at:240:37; Interrogation_Position=930; Antisense; ATCATAGCATACTTCTTGGCGTCAG

Paste this into a BLAST search page for me
CTGTCTGGTGCTGGCCATGATTGAATGGCCACCATTAATGCAGCCGACAAGGATAGTCATCAAGCCGCAGCGGGCGAGGCCATACTGGAGACTATTGATCTGATCCGAAGAGAGCGTCATCCACTGTCATCCACTCAAGATTTCGCACTGCAAATTTACTTCAGGACATTCCGGTGAGTCACGAGCGAGATTCCAAACAGACAGAAGCCATTTTATTCCCTCTTGCCCAGATGTTCTAGTGTTGCCCAAATTTTCATTCAATCTTTCGTTCTCAATCGTTCTCAACAATCACTCATCAAAGTACTAGTTTTCACCGTTCATTTCAATCATAGCATACTTCTTGGCGTCAG

Full Affymetrix probeset data:

Annotations for 1639874_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720