FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639875_at:

>probe:Drosophila_2:1639875_at:522:369; Interrogation_Position=398; Antisense; GAATGATGGTCGATCTGTCCCACGT
>probe:Drosophila_2:1639875_at:329:73; Interrogation_Position=461; Antisense; AGGCACCTGTGATATTCTCGCATTC
>probe:Drosophila_2:1639875_at:118:629; Interrogation_Position=487; Antisense; TCCGCCTACGAGCTGTGCAATACGA
>probe:Drosophila_2:1639875_at:327:27; Interrogation_Position=506; Antisense; ATACGAGCCGAAACGTCCAGGACGA
>probe:Drosophila_2:1639875_at:78:107; Interrogation_Position=551; Antisense; AGAACGGCGGCCTGGTCATGGTCAA
>probe:Drosophila_2:1639875_at:569:537; Interrogation_Position=564; Antisense; GGTCATGGTCAACTTCTACTCGAAG
>probe:Drosophila_2:1639875_at:356:373; Interrogation_Position=585; Antisense; GAAGTTCCTATCCTGCAGCGACAAC
>probe:Drosophila_2:1639875_at:635:509; Interrogation_Position=616; Antisense; GTGCACGATGCAGTCGCGCATATTA
>probe:Drosophila_2:1639875_at:159:659; Interrogation_Position=648; Antisense; TAAGCGAGTCGCAGGCATCGATCAC
>probe:Drosophila_2:1639875_at:88:43; Interrogation_Position=664; Antisense; ATCGATCACGTTGGACTGGGCGCCG
>probe:Drosophila_2:1639875_at:79:549; Interrogation_Position=726; Antisense; GGATGTGTCTTCATATCCGACTCTA
>probe:Drosophila_2:1639875_at:192:137; Interrogation_Position=793; Antisense; ACGAAGCTGGCAGGCGGCAATTTCC
>probe:Drosophila_2:1639875_at:198:245; Interrogation_Position=811; Antisense; AATTTCCTCAGGGTCATGCAGCAGG
>probe:Drosophila_2:1639875_at:377:511; Interrogation_Position=871; Antisense; GTGAAACCCTTCGAGGATCATCCGA

Paste this into a BLAST search page for me
GAATGATGGTCGATCTGTCCCACGTAGGCACCTGTGATATTCTCGCATTCTCCGCCTACGAGCTGTGCAATACGAATACGAGCCGAAACGTCCAGGACGAAGAACGGCGGCCTGGTCATGGTCAAGGTCATGGTCAACTTCTACTCGAAGGAAGTTCCTATCCTGCAGCGACAACGTGCACGATGCAGTCGCGCATATTATAAGCGAGTCGCAGGCATCGATCACATCGATCACGTTGGACTGGGCGCCGGGATGTGTCTTCATATCCGACTCTAACGAAGCTGGCAGGCGGCAATTTCCAATTTCCTCAGGGTCATGCAGCAGGGTGAAACCCTTCGAGGATCATCCGA

Full Affymetrix probeset data:

Annotations for 1639875_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720