Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639877_at:

>probe:Drosophila_2:1639877_at:283:573; Interrogation_Position=1018; Antisense; GGCCTATCTCAAGAACTTCCTATTC
>probe:Drosophila_2:1639877_at:129:677; Interrogation_Position=1161; Antisense; TAGAGCTGTGCCTGATCATCGCCAT
>probe:Drosophila_2:1639877_at:696:347; Interrogation_Position=1198; Antisense; GCAGATTTACGATCGCGATTCCTTC
>probe:Drosophila_2:1639877_at:331:327; Interrogation_Position=1212; Antisense; GCGATTCCTTCAACTTCGAGATCAT
>probe:Drosophila_2:1639877_at:283:717; Interrogation_Position=1226; Antisense; TTCGAGATCATTTACGCGCGCTTTT
>probe:Drosophila_2:1639877_at:276:321; Interrogation_Position=1241; Antisense; GCGCGCTTTTCCAAGTTTGCCAAAG
>probe:Drosophila_2:1639877_at:153:171; Interrogation_Position=1262; Antisense; AAAGTGTCCACCACAATGCAGGCCG
>probe:Drosophila_2:1639877_at:419:587; Interrogation_Position=1287; Antisense; TGGAGCGGTCCATTGTCCTGAAGGC
>probe:Drosophila_2:1639877_at:477:615; Interrogation_Position=1305; Antisense; TGAAGGCCTTCGAGCATTTACGCAT
>probe:Drosophila_2:1639877_at:547:343; Interrogation_Position=1318; Antisense; GCATTTACGCATCGCAGAGCTGATC
>probe:Drosophila_2:1639877_at:630:611; Interrogation_Position=1416; Antisense; TGACATACAGCCAGATTCACCACTG
>probe:Drosophila_2:1639877_at:349:713; Interrogation_Position=1431; Antisense; TTCACCACTGTATGCAGCGATACCA
>probe:Drosophila_2:1639877_at:501:257; Interrogation_Position=1465; Antisense; CACAGAGGTTGCTCAGTGGGCGCAA
>probe:Drosophila_2:1639877_at:532:515; Interrogation_Position=1480; Antisense; GTGGGCGCAAAGCTCTCTGATTTAG

Paste this into a BLAST search page for me
GGCCTATCTCAAGAACTTCCTATTCTAGAGCTGTGCCTGATCATCGCCATGCAGATTTACGATCGCGATTCCTTCGCGATTCCTTCAACTTCGAGATCATTTCGAGATCATTTACGCGCGCTTTTGCGCGCTTTTCCAAGTTTGCCAAAGAAAGTGTCCACCACAATGCAGGCCGTGGAGCGGTCCATTGTCCTGAAGGCTGAAGGCCTTCGAGCATTTACGCATGCATTTACGCATCGCAGAGCTGATCTGACATACAGCCAGATTCACCACTGTTCACCACTGTATGCAGCGATACCACACAGAGGTTGCTCAGTGGGCGCAAGTGGGCGCAAAGCTCTCTGATTTAG

Full Affymetrix probeset data:

Annotations for 1639877_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime