FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639878_at:

>probe:Drosophila_2:1639878_at:348:329; Interrogation_Position=127; Antisense; GCGGACTCCGGATCCGATGTGGCCT
>probe:Drosophila_2:1639878_at:271:295; Interrogation_Position=141; Antisense; CGATGTGGCCTGTCTCCAGGAGATG
>probe:Drosophila_2:1639878_at:63:507; Interrogation_Position=169; Antisense; GTGCTGTTCGCCTGCTTGAAAGACA
>probe:Drosophila_2:1639878_at:275:423; Interrogation_Position=205; Antisense; GAGAAGTACTGCCACAAGGAGATCA
>probe:Drosophila_2:1639878_at:608:223; Interrogation_Position=220; Antisense; AAGGAGATCAGCCAGTTCCAGAACT
>probe:Drosophila_2:1639878_at:46:471; Interrogation_Position=234; Antisense; GTTCCAGAACTGCTACAAGTGCTAC
>probe:Drosophila_2:1639878_at:335:251; Interrogation_Position=249; Antisense; CAAGTGCTACATGGACCGTAAGTTT
>probe:Drosophila_2:1639878_at:194:109; Interrogation_Position=281; Antisense; AGAAGACCGTGAACCAGGGAATCGT
>probe:Drosophila_2:1639878_at:254:81; Interrogation_Position=296; Antisense; AGGGAATCGTCCAACCGGGCAGCAA
>probe:Drosophila_2:1639878_at:87:525; Interrogation_Position=312; Antisense; GGGCAGCAACCTGAACTACAAGCAA
>probe:Drosophila_2:1639878_at:485:147; Interrogation_Position=336; Antisense; ACTTAACAAGTACATGCGCCGCTAC
>probe:Drosophila_2:1639878_at:180:225; Interrogation_Position=67; Antisense; AAGGACGTGCCCTTCCAGGAGATTC
>probe:Drosophila_2:1639878_at:18:77; Interrogation_Position=83; Antisense; AGGAGATTCTGCCTCTGCGGCTGAA
>probe:Drosophila_2:1639878_at:354:641; Interrogation_Position=96; Antisense; TCTGCGGCTGAAGAACACCGTGAGC

Paste this into a BLAST search page for me
GCGGACTCCGGATCCGATGTGGCCTCGATGTGGCCTGTCTCCAGGAGATGGTGCTGTTCGCCTGCTTGAAAGACAGAGAAGTACTGCCACAAGGAGATCAAAGGAGATCAGCCAGTTCCAGAACTGTTCCAGAACTGCTACAAGTGCTACCAAGTGCTACATGGACCGTAAGTTTAGAAGACCGTGAACCAGGGAATCGTAGGGAATCGTCCAACCGGGCAGCAAGGGCAGCAACCTGAACTACAAGCAAACTTAACAAGTACATGCGCCGCTACAAGGACGTGCCCTTCCAGGAGATTCAGGAGATTCTGCCTCTGCGGCTGAATCTGCGGCTGAAGAACACCGTGAGC

Full Affymetrix probeset data:

Annotations for 1639878_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720