FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639881_at:

>probe:Drosophila_2:1639881_at:229:609; Interrogation_Position=114; Antisense; TGCACGAGAACCAAACCCTTTTCAT
>probe:Drosophila_2:1639881_at:681:719; Interrogation_Position=138; Antisense; TTCCCTTCCTGCACTGCGGAAAATT
>probe:Drosophila_2:1639881_at:106:387; Interrogation_Position=156; Antisense; GAAAATTTTTCGCACCTTGTACGTG
>probe:Drosophila_2:1639881_at:484:185; Interrogation_Position=182; Antisense; AAAATCGAGCGCTGCGGCTACGTGA
>probe:Drosophila_2:1639881_at:194:53; Interrogation_Position=220; Antisense; ATGCAGCAGTACCAGGACGACTCCT
>probe:Drosophila_2:1639881_at:671:565; Interrogation_Position=352; Antisense; GGCAATGTCATCCTAATCGGCTCCG
>probe:Drosophila_2:1639881_at:442:655; Interrogation_Position=365; Antisense; TAATCGGCTCCGTTAAGGACTTCGA
>probe:Drosophila_2:1639881_at:43:331; Interrogation_Position=397; Antisense; GCGGTCCACGGCCTCAAATTGAATG
>probe:Drosophila_2:1639881_at:602:481; Interrogation_Position=41; Antisense; GTATTCGCAATGCTTTTCCATTCTG
>probe:Drosophila_2:1639881_at:391:729; Interrogation_Position=425; Antisense; TTGTGGCTCTGGAGGAGACATCGCA
>probe:Drosophila_2:1639881_at:197:269; Interrogation_Position=443; Antisense; CATCGCAGGGTCTCAGTGGCGGAAC
>probe:Drosophila_2:1639881_at:74:519; Interrogation_Position=509; Antisense; GTGGCACCGAGGTTGAGTACTTCAA
>probe:Drosophila_2:1639881_at:498:695; Interrogation_Position=55; Antisense; TTTCCATTCTGGTCTGTTGTGTTTC
>probe:Drosophila_2:1639881_at:3:391; Interrogation_Position=96; Antisense; GAAACTTTGCCGTAAGCCTGCACGA

Paste this into a BLAST search page for me
TGCACGAGAACCAAACCCTTTTCATTTCCCTTCCTGCACTGCGGAAAATTGAAAATTTTTCGCACCTTGTACGTGAAAATCGAGCGCTGCGGCTACGTGAATGCAGCAGTACCAGGACGACTCCTGGCAATGTCATCCTAATCGGCTCCGTAATCGGCTCCGTTAAGGACTTCGAGCGGTCCACGGCCTCAAATTGAATGGTATTCGCAATGCTTTTCCATTCTGTTGTGGCTCTGGAGGAGACATCGCACATCGCAGGGTCTCAGTGGCGGAACGTGGCACCGAGGTTGAGTACTTCAATTTCCATTCTGGTCTGTTGTGTTTCGAAACTTTGCCGTAAGCCTGCACGA

Full Affymetrix probeset data:

Annotations for 1639881_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720