FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639882_at:

>probe:Drosophila_2:1639882_at:180:57; Interrogation_Position=1008; Antisense; ATGACGCAGGCGAACCCATGGAGAC
>probe:Drosophila_2:1639882_at:679:435; Interrogation_Position=1052; Antisense; GAGGAAGTACCCATCAATAGCCATT
>probe:Drosophila_2:1639882_at:449:693; Interrogation_Position=1075; Antisense; TTTCCAAAAGAATCGCTTCTCGCCG
>probe:Drosophila_2:1639882_at:319:319; Interrogation_Position=1096; Antisense; GCCGCTGGCTAGAAAACCTCTGTGT
>probe:Drosophila_2:1639882_at:98:203; Interrogation_Position=1110; Antisense; AACCTCTGTGTCAGTGATGCTGGCC
>probe:Drosophila_2:1639882_at:641:481; Interrogation_Position=1150; Antisense; GTATTGACACCCAACGCCTGAGAAG
>probe:Drosophila_2:1639882_at:114:379; Interrogation_Position=1171; Antisense; GAAGCGTTCATATCGCGGAATACAT
>probe:Drosophila_2:1639882_at:117:701; Interrogation_Position=1200; Antisense; TTTTGGTTACTCCACGCATTTCAAC
>probe:Drosophila_2:1639882_at:67:345; Interrogation_Position=1215; Antisense; GCATTTCAACCACAGACTACAGCGA
>probe:Drosophila_2:1639882_at:477:409; Interrogation_Position=1252; Antisense; GACGACTTTGCACCTTAAGACTACT
>probe:Drosophila_2:1639882_at:86:345; Interrogation_Position=1340; Antisense; GCTTGTTCTCGCATATTGTTTCTTT
>probe:Drosophila_2:1639882_at:328:299; Interrogation_Position=890; Antisense; CGCCAGCGACAGAGTGTTCCAGTTA
>probe:Drosophila_2:1639882_at:216:93; Interrogation_Position=910; Antisense; AGTTAGTGGATCCAATCTGGCCCGT
>probe:Drosophila_2:1639882_at:185:415; Interrogation_Position=952; Antisense; GACCACCGCAGTAAACACTCTATAT

Paste this into a BLAST search page for me
ATGACGCAGGCGAACCCATGGAGACGAGGAAGTACCCATCAATAGCCATTTTTCCAAAAGAATCGCTTCTCGCCGGCCGCTGGCTAGAAAACCTCTGTGTAACCTCTGTGTCAGTGATGCTGGCCGTATTGACACCCAACGCCTGAGAAGGAAGCGTTCATATCGCGGAATACATTTTTGGTTACTCCACGCATTTCAACGCATTTCAACCACAGACTACAGCGAGACGACTTTGCACCTTAAGACTACTGCTTGTTCTCGCATATTGTTTCTTTCGCCAGCGACAGAGTGTTCCAGTTAAGTTAGTGGATCCAATCTGGCCCGTGACCACCGCAGTAAACACTCTATAT

Full Affymetrix probeset data:

Annotations for 1639882_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720