FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639883_at:

>probe:Drosophila_2:1639883_at:21:609; Interrogation_Position=3204; Antisense; TGAGGGATCAGTTGGCCACGCTTCT
>probe:Drosophila_2:1639883_at:678:275; Interrogation_Position=3224; Antisense; CTTCTTCGTCGCAGTCACTTTGAAA
>probe:Drosophila_2:1639883_at:352:93; Interrogation_Position=3264; Antisense; AGTTACATCGTTATGTGGCCGGCAA
>probe:Drosophila_2:1639883_at:87:165; Interrogation_Position=3296; Antisense; AAATCAGGAGGAAAACGCCGCAACT
>probe:Drosophila_2:1639883_at:304:677; Interrogation_Position=3331; Antisense; TAGACTCCAAGCTAACCGACAAGTT
>probe:Drosophila_2:1639883_at:683:681; Interrogation_Position=3355; Antisense; TATGGGCATCGTATTGGCGCTGCAA
>probe:Drosophila_2:1639883_at:288:577; Interrogation_Position=3370; Antisense; GGCGCTGCAAGATTCCGCTTTATGA
>probe:Drosophila_2:1639883_at:698:259; Interrogation_Position=3401; Antisense; CACGCAGCGTTGAGATTTGTTTTTA
>probe:Drosophila_2:1639883_at:516:291; Interrogation_Position=3459; Antisense; CGAAGGCTTCGGTGTTTGTGTGCCA
>probe:Drosophila_2:1639883_at:490:247; Interrogation_Position=3564; Antisense; AATTGGATGAGAGCTATTCGCGGGA
>probe:Drosophila_2:1639883_at:230:445; Interrogation_Position=3590; Antisense; GATGAAGTGCCCCATAATGCTGGTT
>probe:Drosophila_2:1639883_at:318:17; Interrogation_Position=3687; Antisense; ATTTTCTTTGATCAATGCCTCTCTA
>probe:Drosophila_2:1639883_at:12:235; Interrogation_Position=3700; Antisense; AATGCCTCTCTAAATACCTTGTGTC
>probe:Drosophila_2:1639883_at:348:129; Interrogation_Position=3715; Antisense; ACCTTGTGTCGTAAACAGAACCTGT

Paste this into a BLAST search page for me
TGAGGGATCAGTTGGCCACGCTTCTCTTCTTCGTCGCAGTCACTTTGAAAAGTTACATCGTTATGTGGCCGGCAAAAATCAGGAGGAAAACGCCGCAACTTAGACTCCAAGCTAACCGACAAGTTTATGGGCATCGTATTGGCGCTGCAAGGCGCTGCAAGATTCCGCTTTATGACACGCAGCGTTGAGATTTGTTTTTACGAAGGCTTCGGTGTTTGTGTGCCAAATTGGATGAGAGCTATTCGCGGGAGATGAAGTGCCCCATAATGCTGGTTATTTTCTTTGATCAATGCCTCTCTAAATGCCTCTCTAAATACCTTGTGTCACCTTGTGTCGTAAACAGAACCTGT

Full Affymetrix probeset data:

Annotations for 1639883_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720