Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639884_at:

>probe:Drosophila_2:1639884_at:644:367; Interrogation_Position=110; Antisense; GAATGCCCAGGCTCATGGTACCGGT
>probe:Drosophila_2:1639884_at:31:539; Interrogation_Position=126; Antisense; GGTACCGGTGCGACTGATTATCATC
>probe:Drosophila_2:1639884_at:90:705; Interrogation_Position=143; Antisense; TTATCATCCATCATACAGTCACGGC
>probe:Drosophila_2:1639884_at:617:377; Interrogation_Position=15; Antisense; GAAGCTACAGTTGGCTCTCGTTCTA
>probe:Drosophila_2:1639884_at:664:711; Interrogation_Position=175; Antisense; TTCAATCCGCATCAGTGCCAGTTGG
>probe:Drosophila_2:1639884_at:377:247; Interrogation_Position=210; Antisense; AATTCGAGCCGATCATATGCGCAGA
>probe:Drosophila_2:1639884_at:403:3; Interrogation_Position=247; Antisense; ATTGGCTATAATTTCCTGATCGGCG
>probe:Drosophila_2:1639884_at:696:643; Interrogation_Position=284; Antisense; TCTACGAGGGCTTGGGTTTCGGCAT
>probe:Drosophila_2:1639884_at:714:341; Interrogation_Position=355; Antisense; GCTTTCATTGGCAACTTCCAGACTG
>probe:Drosophila_2:1639884_at:310:105; Interrogation_Position=374; Antisense; AGACTGGATTACCTCCTTCGCAGAT
>probe:Drosophila_2:1639884_at:469:63; Interrogation_Position=39; Antisense; ATGTGGATTGACTCTGGCCTTGGGC
>probe:Drosophila_2:1639884_at:334:191; Interrogation_Position=457; Antisense; AACTATTCCGTGGTGGGTCATTGCC
>probe:Drosophila_2:1639884_at:384:371; Interrogation_Position=486; Antisense; GAAGGCCACTGCTTGTCCGGGAATA
>probe:Drosophila_2:1639884_at:91:363; Interrogation_Position=506; Antisense; GAATACACCTTCTCAACGAGCTCAA

Paste this into a BLAST search page for me
GAATGCCCAGGCTCATGGTACCGGTGGTACCGGTGCGACTGATTATCATCTTATCATCCATCATACAGTCACGGCGAAGCTACAGTTGGCTCTCGTTCTATTCAATCCGCATCAGTGCCAGTTGGAATTCGAGCCGATCATATGCGCAGAATTGGCTATAATTTCCTGATCGGCGTCTACGAGGGCTTGGGTTTCGGCATGCTTTCATTGGCAACTTCCAGACTGAGACTGGATTACCTCCTTCGCAGATATGTGGATTGACTCTGGCCTTGGGCAACTATTCCGTGGTGGGTCATTGCCGAAGGCCACTGCTTGTCCGGGAATAGAATACACCTTCTCAACGAGCTCAA

Full Affymetrix probeset data:

Annotations for 1639884_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime