Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639885_at:

>probe:Drosophila_2:1639885_at:553:89; Interrogation_Position=1657; Antisense; AGTCATCAGTACAACATGGCCCAAA
>probe:Drosophila_2:1639885_at:689:119; Interrogation_Position=1805; Antisense; AGCTGTACACGAATGCGGTTCTCAA
>probe:Drosophila_2:1639885_at:220:209; Interrogation_Position=1845; Antisense; AAGCTATTCCGCCAGTGGTTGGCAC
>probe:Drosophila_2:1639885_at:261:489; Interrogation_Position=1887; Antisense; GTACGGACTGTACCAGAACGCTGCC
>probe:Drosophila_2:1639885_at:422:319; Interrogation_Position=1912; Antisense; GCCGCGTATTACCAGCCGGAATACA
>probe:Drosophila_2:1639885_at:399:241; Interrogation_Position=1931; Antisense; AATACATTCCCCTGGAGATCGGCTA
>probe:Drosophila_2:1639885_at:507:291; Interrogation_Position=1967; Antisense; CGTTGGAGCCCGTTGATGTTTCAAA
>probe:Drosophila_2:1639885_at:398:599; Interrogation_Position=1983; Antisense; TGTTTCAAAGACACTGGACGACCCC
>probe:Drosophila_2:1639885_at:15:337; Interrogation_Position=2011; Antisense; GCTGCCATGTACAAGCCGAGCGATG
>probe:Drosophila_2:1639885_at:361:115; Interrogation_Position=2036; Antisense; AGCAGGGCTCGGTCATAACGCTGGA
>probe:Drosophila_2:1639885_at:192:29; Interrogation_Position=2050; Antisense; ATAACGCTGGAGTGCGCCAGTTCCT
>probe:Drosophila_2:1639885_at:90:615; Interrogation_Position=2078; Antisense; TGAAGAGCTCTCACGACATCAAGAT
>probe:Drosophila_2:1639885_at:179:215; Interrogation_Position=2098; Antisense; AAGATAGAGTCCTCATCCCTGGAGC
>probe:Drosophila_2:1639885_at:593:199; Interrogation_Position=2175; Antisense; AACCGCCGTGGTGAATGGAGCTCCG

Paste this into a BLAST search page for me
AGTCATCAGTACAACATGGCCCAAAAGCTGTACACGAATGCGGTTCTCAAAAGCTATTCCGCCAGTGGTTGGCACGTACGGACTGTACCAGAACGCTGCCGCCGCGTATTACCAGCCGGAATACAAATACATTCCCCTGGAGATCGGCTACGTTGGAGCCCGTTGATGTTTCAAATGTTTCAAAGACACTGGACGACCCCGCTGCCATGTACAAGCCGAGCGATGAGCAGGGCTCGGTCATAACGCTGGAATAACGCTGGAGTGCGCCAGTTCCTTGAAGAGCTCTCACGACATCAAGATAAGATAGAGTCCTCATCCCTGGAGCAACCGCCGTGGTGAATGGAGCTCCG

Full Affymetrix probeset data:

Annotations for 1639885_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime