FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639890_at:

>probe:Drosophila_2:1639890_at:536:285; Interrogation_Position=1003; Antisense; CTGTGCCATTTGTTGTACGCTATAT
>probe:Drosophila_2:1639890_at:328:207; Interrogation_Position=1161; Antisense; AAGCGTACTACTACCATCTAGGCAG
>probe:Drosophila_2:1639890_at:619:15; Interrogation_Position=682; Antisense; ATTATAGCACCCAATCACCTATGCA
>probe:Drosophila_2:1639890_at:600:239; Interrogation_Position=694; Antisense; AATCACCTATGCAAAACTCTTCCAC
>probe:Drosophila_2:1639890_at:380:279; Interrogation_Position=710; Antisense; CTCTTCCACAAAAACACCTACAGGT
>probe:Drosophila_2:1639890_at:120:417; Interrogation_Position=784; Antisense; GAGCGCCAATTGTTGCGTTTCACGT
>probe:Drosophila_2:1639890_at:222:563; Interrogation_Position=810; Antisense; GGAATTTCACTGATTTCTCTTGCCG
>probe:Drosophila_2:1639890_at:93:319; Interrogation_Position=831; Antisense; GCCGGTTTCTATGTGCTTGTATCAA
>probe:Drosophila_2:1639890_at:548:503; Interrogation_Position=870; Antisense; GTCCCAGCTCTGGAGTGTATTGGAA
>probe:Drosophila_2:1639890_at:535:481; Interrogation_Position=886; Antisense; GTATTGGAATTGCATCACCCGCTAT
>probe:Drosophila_2:1639890_at:688:419; Interrogation_Position=932; Antisense; GAGCACCTTTGTTGTTGCGTATGCC
>probe:Drosophila_2:1639890_at:371:623; Interrogation_Position=947; Antisense; TGCGTATGCCGTACACAAAGTCTTT
>probe:Drosophila_2:1639890_at:549:217; Interrogation_Position=964; Antisense; AAGTCTTTGCCCCTGCTAGAATAAG
>probe:Drosophila_2:1639890_at:140:483; Interrogation_Position=988; Antisense; GTATCACGTTAGGTTCTGTGCCATT

Paste this into a BLAST search page for me
CTGTGCCATTTGTTGTACGCTATATAAGCGTACTACTACCATCTAGGCAGATTATAGCACCCAATCACCTATGCAAATCACCTATGCAAAACTCTTCCACCTCTTCCACAAAAACACCTACAGGTGAGCGCCAATTGTTGCGTTTCACGTGGAATTTCACTGATTTCTCTTGCCGGCCGGTTTCTATGTGCTTGTATCAAGTCCCAGCTCTGGAGTGTATTGGAAGTATTGGAATTGCATCACCCGCTATGAGCACCTTTGTTGTTGCGTATGCCTGCGTATGCCGTACACAAAGTCTTTAAGTCTTTGCCCCTGCTAGAATAAGGTATCACGTTAGGTTCTGTGCCATT

Full Affymetrix probeset data:

Annotations for 1639890_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720