Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639891_at:

>probe:Drosophila_2:1639891_at:134:649; Interrogation_Position=575; Antisense; TCAAGAACCAAGTCGGTTTCCTCAC
>probe:Drosophila_2:1639891_at:351:199; Interrogation_Position=619; Antisense; AACGCCATCATCTCCAGGTACGAAG
>probe:Drosophila_2:1639891_at:271:217; Interrogation_Position=663; Antisense; AAGTATCATGGCAAGTCTCCAGAAG
>probe:Drosophila_2:1639891_at:451:175; Interrogation_Position=701; Antisense; AAACGCGCCATCAGAAGATTCACAA
>probe:Drosophila_2:1639891_at:441:207; Interrogation_Position=740; Antisense; AAGCTGATGTCAGATCGATCCCTTC
>probe:Drosophila_2:1639891_at:362:719; Interrogation_Position=762; Antisense; TTCCGAACAGCTACCAATGCCCAAG
>probe:Drosophila_2:1639891_at:579:233; Interrogation_Position=777; Antisense; AATGCCCAAGCCGAGTGATCAAATA
>probe:Drosophila_2:1639891_at:512:225; Interrogation_Position=838; Antisense; AAGGAAGATTCCAGCTCGGCGGGCT
>probe:Drosophila_2:1639891_at:357:575; Interrogation_Position=855; Antisense; GGCGGGCTCTGATAAGCCACCAAGT
>probe:Drosophila_2:1639891_at:240:699; Interrogation_Position=879; Antisense; TTTTGAGGCGAATCCCAGGTCTTCA
>probe:Drosophila_2:1639891_at:251:9; Interrogation_Position=907; Antisense; ATTCGATCCCATAACTTGGACTGCC
>probe:Drosophila_2:1639891_at:281:627; Interrogation_Position=928; Antisense; TGCCTCTCCTCTGCGCTGAAAAATA
>probe:Drosophila_2:1639891_at:343:189; Interrogation_Position=968; Antisense; AACAGTCAACTGTCGAGGGATGATC
>probe:Drosophila_2:1639891_at:428:547; Interrogation_Position=985; Antisense; GGATGATCTGATTTCGTACCCATTA

Paste this into a BLAST search page for me
TCAAGAACCAAGTCGGTTTCCTCACAACGCCATCATCTCCAGGTACGAAGAAGTATCATGGCAAGTCTCCAGAAGAAACGCGCCATCAGAAGATTCACAAAAGCTGATGTCAGATCGATCCCTTCTTCCGAACAGCTACCAATGCCCAAGAATGCCCAAGCCGAGTGATCAAATAAAGGAAGATTCCAGCTCGGCGGGCTGGCGGGCTCTGATAAGCCACCAAGTTTTTGAGGCGAATCCCAGGTCTTCAATTCGATCCCATAACTTGGACTGCCTGCCTCTCCTCTGCGCTGAAAAATAAACAGTCAACTGTCGAGGGATGATCGGATGATCTGATTTCGTACCCATTA

Full Affymetrix probeset data:

Annotations for 1639891_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime