FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639892_at:

>probe:Drosophila_2:1639892_at:450:259; Interrogation_Position=1053; Antisense; CACTCGTTCCGGTGGCATTGTGGTG
>probe:Drosophila_2:1639892_at:393:353; Interrogation_Position=1093; Antisense; GCAGCTGAGATCAAGTTGCCCCTAA
>probe:Drosophila_2:1639892_at:527:213; Interrogation_Position=1105; Antisense; AAGTTGCCCCTAATTAATGCCCTGG
>probe:Drosophila_2:1639892_at:570:217; Interrogation_Position=1213; Antisense; AATGTTAAGCGTCTGGTGACCCACC
>probe:Drosophila_2:1639892_at:678:411; Interrogation_Position=1230; Antisense; GACCCACCATTTCGACATCAAGGAA
>probe:Drosophila_2:1639892_at:370:593; Interrogation_Position=1289; Antisense; TGGGTGGTGCCATCAAGGTCATGAT
>probe:Drosophila_2:1639892_at:648:423; Interrogation_Position=1328; Antisense; GAGACACCAACAATCCTCGCAAATT
>probe:Drosophila_2:1639892_at:701:305; Interrogation_Position=816; Antisense; CCTGGTCACTTTAATGGCTGCTCAA
>probe:Drosophila_2:1639892_at:443:283; Interrogation_Position=833; Antisense; CTGCTCAAGCCATGGGTGCGTCTGA
>probe:Drosophila_2:1639892_at:602:505; Interrogation_Position=848; Antisense; GTGCGTCTGAGATCCTCATTACGGA
>probe:Drosophila_2:1639892_at:705:279; Interrogation_Position=862; Antisense; CTCATTACGGATCTTGTGCAGCAAC
>probe:Drosophila_2:1639892_at:669:211; Interrogation_Position=902; Antisense; AAGAGCTAGGTGCAACTCACACCCT
>probe:Drosophila_2:1639892_at:90:423; Interrogation_Position=955; Antisense; GAGACGGCGGTGCTCGTCCAAAAAA
>probe:Drosophila_2:1639892_at:306:177; Interrogation_Position=977; Antisense; AAACGATGGGCGGTCAGCCGGACAA

Paste this into a BLAST search page for me
CACTCGTTCCGGTGGCATTGTGGTGGCAGCTGAGATCAAGTTGCCCCTAAAAGTTGCCCCTAATTAATGCCCTGGAATGTTAAGCGTCTGGTGACCCACCGACCCACCATTTCGACATCAAGGAATGGGTGGTGCCATCAAGGTCATGATGAGACACCAACAATCCTCGCAAATTCCTGGTCACTTTAATGGCTGCTCAACTGCTCAAGCCATGGGTGCGTCTGAGTGCGTCTGAGATCCTCATTACGGACTCATTACGGATCTTGTGCAGCAACAAGAGCTAGGTGCAACTCACACCCTGAGACGGCGGTGCTCGTCCAAAAAAAAACGATGGGCGGTCAGCCGGACAA

Full Affymetrix probeset data:

Annotations for 1639892_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720