Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639894_at:

>probe:Drosophila_2:1639894_at:321:629; Interrogation_Position=1543; Antisense; TCCACAATCTGCGATGCCCAAGAAA
>probe:Drosophila_2:1639894_at:242:393; Interrogation_Position=1564; Antisense; GAAAGGAGTCGGTTCACCAGTGGAT
>probe:Drosophila_2:1639894_at:377:189; Interrogation_Position=1597; Antisense; AACTCTACTGAGTGCCCAACGAAAG
>probe:Drosophila_2:1639894_at:641:205; Interrogation_Position=1645; Antisense; AAGCGCATCACACCAAATTCGGAGT
>probe:Drosophila_2:1639894_at:110:245; Interrogation_Position=1660; Antisense; AATTCGGAGTCCCATTACTCAGTCG
>probe:Drosophila_2:1639894_at:370:649; Interrogation_Position=1678; Antisense; TCAGTCGCCAAGTCAAGCTTCAGAA
>probe:Drosophila_2:1639894_at:240:179; Interrogation_Position=1711; Antisense; AACACCACCGACTCATTTCGAAATG
>probe:Drosophila_2:1639894_at:171:429; Interrogation_Position=1830; Antisense; GAGTTGGCTTCTTCTCTAAGCTGTC
>probe:Drosophila_2:1639894_at:316:333; Interrogation_Position=1849; Antisense; GCTGTCCGCACGCTTTGTTAGAAGA
>probe:Drosophila_2:1639894_at:721:373; Interrogation_Position=1869; Antisense; GAAGATCACTCCACAAGGGCGAAAA
>probe:Drosophila_2:1639894_at:492:223; Interrogation_Position=1932; Antisense; AAGGTGTTAGTTTAGCGCATCCCAA
>probe:Drosophila_2:1639894_at:243:543; Interrogation_Position=1959; Antisense; GGATTCTTTCCTGCACAGATAATCG
>probe:Drosophila_2:1639894_at:161:393; Interrogation_Position=1983; Antisense; GAAAGTGATATAGCAGCCCTCCCGA
>probe:Drosophila_2:1639894_at:216:139; Interrogation_Position=2012; Antisense; ACGATCGATCCACCTTATGTCTAAA

Paste this into a BLAST search page for me
TCCACAATCTGCGATGCCCAAGAAAGAAAGGAGTCGGTTCACCAGTGGATAACTCTACTGAGTGCCCAACGAAAGAAGCGCATCACACCAAATTCGGAGTAATTCGGAGTCCCATTACTCAGTCGTCAGTCGCCAAGTCAAGCTTCAGAAAACACCACCGACTCATTTCGAAATGGAGTTGGCTTCTTCTCTAAGCTGTCGCTGTCCGCACGCTTTGTTAGAAGAGAAGATCACTCCACAAGGGCGAAAAAAGGTGTTAGTTTAGCGCATCCCAAGGATTCTTTCCTGCACAGATAATCGGAAAGTGATATAGCAGCCCTCCCGAACGATCGATCCACCTTATGTCTAAA

Full Affymetrix probeset data:

Annotations for 1639894_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime