FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639897_at:

>probe:Drosophila_2:1639897_at:29:513; Interrogation_Position=1002; Antisense; GTGATCAAGCATCGCGTCTTGCCAA
>probe:Drosophila_2:1639897_at:501:187; Interrogation_Position=1060; Antisense; AACACTTACAGGTTCTAGAGCTCAG
>probe:Drosophila_2:1639897_at:533:331; Interrogation_Position=1089; Antisense; GCTGGCCCTCCATTAAGAATTCTTA
>probe:Drosophila_2:1639897_at:694:405; Interrogation_Position=666; Antisense; GACTCCAGGCCATGCATGTCATCAA
>probe:Drosophila_2:1639897_at:14:209; Interrogation_Position=710; Antisense; AAGCTCATATCCATGATGTCGCCCT
>probe:Drosophila_2:1639897_at:254:347; Interrogation_Position=724; Antisense; GATGTCGCCCTTCCTAAGGGAGGAA
>probe:Drosophila_2:1639897_at:572:189; Interrogation_Position=755; Antisense; AACATGATCCGGTACCACACAGAGG
>probe:Drosophila_2:1639897_at:688:219; Interrogation_Position=801; Antisense; AAGTGCCCAGGGACATGTTGCCGAA
>probe:Drosophila_2:1639897_at:245:71; Interrogation_Position=840; Antisense; AGGCGGGCACTGTAGCGGAACTCAA
>probe:Drosophila_2:1639897_at:422:575; Interrogation_Position=865; Antisense; GGCGAAAGGCATTCAGTCCATCAGG
>probe:Drosophila_2:1639897_at:661:501; Interrogation_Position=880; Antisense; GTCCATCAGGGACAACGCGGCTTAT
>probe:Drosophila_2:1639897_at:93:705; Interrogation_Position=901; Antisense; TTATCTCAGCGACGAGCGGTACTGG
>probe:Drosophila_2:1639897_at:531:107; Interrogation_Position=941; Antisense; AGCAAGAGTCGGTGGTCCTGGTTCT
>probe:Drosophila_2:1639897_at:66:505; Interrogation_Position=955; Antisense; GTCCTGGTTCTGATATCCTGATCAT

Paste this into a BLAST search page for me
GTGATCAAGCATCGCGTCTTGCCAAAACACTTACAGGTTCTAGAGCTCAGGCTGGCCCTCCATTAAGAATTCTTAGACTCCAGGCCATGCATGTCATCAAAAGCTCATATCCATGATGTCGCCCTGATGTCGCCCTTCCTAAGGGAGGAAAACATGATCCGGTACCACACAGAGGAAGTGCCCAGGGACATGTTGCCGAAAGGCGGGCACTGTAGCGGAACTCAAGGCGAAAGGCATTCAGTCCATCAGGGTCCATCAGGGACAACGCGGCTTATTTATCTCAGCGACGAGCGGTACTGGAGCAAGAGTCGGTGGTCCTGGTTCTGTCCTGGTTCTGATATCCTGATCAT

Full Affymetrix probeset data:

Annotations for 1639897_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720