FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639898_at:

>probe:Drosophila_2:1639898_at:311:261; Interrogation_Position=1011; Antisense; CACCCGTTGGTGATGAAGCTGATTT
>probe:Drosophila_2:1639898_at:192:375; Interrogation_Position=1025; Antisense; GAAGCTGATTTTCAACCCGGAGGTG
>probe:Drosophila_2:1639898_at:152:239; Interrogation_Position=1079; Antisense; AATAACGTCGCGCATGTACGAGGAT
>probe:Drosophila_2:1639898_at:266:615; Interrogation_Position=1182; Antisense; TGCAGCTATTATCACGGCGTCGGTT
>probe:Drosophila_2:1639898_at:454:579; Interrogation_Position=1240; Antisense; TCGAGGATTACCTTTCGGAATTACA
>probe:Drosophila_2:1639898_at:206:51; Interrogation_Position=1268; Antisense; ATGCTCCAAAGATCACTGGTCTCAG
>probe:Drosophila_2:1639898_at:97:555; Interrogation_Position=1352; Antisense; GGACGATTTTGTTGCCGATTAACTA
>probe:Drosophila_2:1639898_at:263:163; Interrogation_Position=1406; Antisense; AAATTTGCGGGCTTCAGTTTGTGCT
>probe:Drosophila_2:1639898_at:234:413; Interrogation_Position=873; Antisense; GAGGTTTTCTTTATAGCTGTTCGAT
>probe:Drosophila_2:1639898_at:642:439; Interrogation_Position=895; Antisense; GATGGCTGGGTCACGATTGGAACAA
>probe:Drosophila_2:1639898_at:243:353; Interrogation_Position=929; Antisense; GCACGTACGTCGTTTAATGTCCTGT
>probe:Drosophila_2:1639898_at:269:231; Interrogation_Position=944; Antisense; AATGTCCTGTATTCGATTCAACCTG
>probe:Drosophila_2:1639898_at:540:461; Interrogation_Position=958; Antisense; GATTCAACCTGATGCCATTGTGGTA
>probe:Drosophila_2:1639898_at:236:539; Interrogation_Position=979; Antisense; GGTATCTACTATATGCGCGACGGGA

Paste this into a BLAST search page for me
CACCCGTTGGTGATGAAGCTGATTTGAAGCTGATTTTCAACCCGGAGGTGAATAACGTCGCGCATGTACGAGGATTGCAGCTATTATCACGGCGTCGGTTTCGAGGATTACCTTTCGGAATTACAATGCTCCAAAGATCACTGGTCTCAGGGACGATTTTGTTGCCGATTAACTAAAATTTGCGGGCTTCAGTTTGTGCTGAGGTTTTCTTTATAGCTGTTCGATGATGGCTGGGTCACGATTGGAACAAGCACGTACGTCGTTTAATGTCCTGTAATGTCCTGTATTCGATTCAACCTGGATTCAACCTGATGCCATTGTGGTAGGTATCTACTATATGCGCGACGGGA

Full Affymetrix probeset data:

Annotations for 1639898_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720