FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639900_at:

>probe:Drosophila_2:1639900_at:152:705; Interrogation_Position=1028; Antisense; TTACTCAGACTTCCCAGACATTTAG
>probe:Drosophila_2:1639900_at:194:271; Interrogation_Position=1046; Antisense; CATTTAGTGGGCGTCCAACCGCAAA
>probe:Drosophila_2:1639900_at:209:119; Interrogation_Position=522; Antisense; AGCTGATGAGTCACCTTGGCCATCG
>probe:Drosophila_2:1639900_at:268:639; Interrogation_Position=544; Antisense; TCGTCTCAACTACCTGCAAGTGGTG
>probe:Drosophila_2:1639900_at:317:433; Interrogation_Position=588; Antisense; GAGTGCCTCTTCAAGCTCCAGTAGA
>probe:Drosophila_2:1639900_at:533:77; Interrogation_Position=612; Antisense; AGGATCAAGCTATGGTCACTCCACC
>probe:Drosophila_2:1639900_at:100:65; Interrogation_Position=713; Antisense; ATGTGGCGTCCCTGGTGATCAACTG
>probe:Drosophila_2:1639900_at:205:557; Interrogation_Position=737; Antisense; GGACTCCGGATGATATTCACCTGAA
>probe:Drosophila_2:1639900_at:117:691; Interrogation_Position=790; Antisense; TTTGTTGCCCCAAAGAGGTGCTGGA
>probe:Drosophila_2:1639900_at:206:333; Interrogation_Position=809; Antisense; GCTGGACTTGAAACCGCACCGAACT
>probe:Drosophila_2:1639900_at:417:415; Interrogation_Position=886; Antisense; GAGCCACCGATCATCTCTAGCAGAG
>probe:Drosophila_2:1639900_at:360:717; Interrogation_Position=919; Antisense; TTCGGCTATAGAGATGGCTGCTGCT
>probe:Drosophila_2:1639900_at:521:335; Interrogation_Position=935; Antisense; GCTGCTGCTCACTTCTTAAAGTCAT
>probe:Drosophila_2:1639900_at:43:367; Interrogation_Position=993; Antisense; GAATCTCTGCATTTACTTATTTCCC

Paste this into a BLAST search page for me
TTACTCAGACTTCCCAGACATTTAGCATTTAGTGGGCGTCCAACCGCAAAAGCTGATGAGTCACCTTGGCCATCGTCGTCTCAACTACCTGCAAGTGGTGGAGTGCCTCTTCAAGCTCCAGTAGAAGGATCAAGCTATGGTCACTCCACCATGTGGCGTCCCTGGTGATCAACTGGGACTCCGGATGATATTCACCTGAATTTGTTGCCCCAAAGAGGTGCTGGAGCTGGACTTGAAACCGCACCGAACTGAGCCACCGATCATCTCTAGCAGAGTTCGGCTATAGAGATGGCTGCTGCTGCTGCTGCTCACTTCTTAAAGTCATGAATCTCTGCATTTACTTATTTCCC

Full Affymetrix probeset data:

Annotations for 1639900_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720