FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639902_at:

>probe:Drosophila_2:1639902_at:91:669; Interrogation_Position=124; Antisense; TACTTACGTCGAGGAGCCACAGTTC
>probe:Drosophila_2:1639902_at:657:465; Interrogation_Position=13; Antisense; GTTGTCAACTGCATAGCGGCCAGGA
>probe:Drosophila_2:1639902_at:611:257; Interrogation_Position=141; Antisense; CACAGTTCTCTGAGCAGTGCGGCAA
>probe:Drosophila_2:1639902_at:527:189; Interrogation_Position=164; Antisense; AACAGTCGTTGTGGACAGCCCCAAA
>probe:Drosophila_2:1639902_at:176:321; Interrogation_Position=181; Antisense; GCCCCAAACTGCGTATGAGGTCTAT
>probe:Drosophila_2:1639902_at:621:435; Interrogation_Position=197; Antisense; GAGGTCTATCAGAGAATCCTGCTAA
>probe:Drosophila_2:1639902_at:40:267; Interrogation_Position=233; Antisense; CAGGAACATACACGCTCCACAGAAG
>probe:Drosophila_2:1639902_at:665:25; Interrogation_Position=25; Antisense; ATAGCGGCCAGGACACACATCTAGT
>probe:Drosophila_2:1639902_at:222:375; Interrogation_Position=280; Antisense; GAAGTTCTGGATAGCCAGCTTCACT
>probe:Drosophila_2:1639902_at:159:529; Interrogation_Position=305; Antisense; GGGAGGCCCTTGCAATATCAATGTT
>probe:Drosophila_2:1639902_at:631:275; Interrogation_Position=448; Antisense; CTTAAGCTACTTACCCATCAGATTT
>probe:Drosophila_2:1639902_at:199:495; Interrogation_Position=48; Antisense; GTCAGCGGAGTAAATCAGCGTCAGT
>probe:Drosophila_2:1639902_at:332:127; Interrogation_Position=79; Antisense; AGCCAAGATGATACCGCACAGCGAG
>probe:Drosophila_2:1639902_at:460:261; Interrogation_Position=97; Antisense; CAGCGAGAATCCTTTTTCGATCGAG

Paste this into a BLAST search page for me
TACTTACGTCGAGGAGCCACAGTTCGTTGTCAACTGCATAGCGGCCAGGACACAGTTCTCTGAGCAGTGCGGCAAAACAGTCGTTGTGGACAGCCCCAAAGCCCCAAACTGCGTATGAGGTCTATGAGGTCTATCAGAGAATCCTGCTAACAGGAACATACACGCTCCACAGAAGATAGCGGCCAGGACACACATCTAGTGAAGTTCTGGATAGCCAGCTTCACTGGGAGGCCCTTGCAATATCAATGTTCTTAAGCTACTTACCCATCAGATTTGTCAGCGGAGTAAATCAGCGTCAGTAGCCAAGATGATACCGCACAGCGAGCAGCGAGAATCCTTTTTCGATCGAG

Full Affymetrix probeset data:

Annotations for 1639902_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720