FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639903_at:

>probe:Drosophila_2:1639903_at:1:597; Interrogation_Position=467; Antisense; TGTGGATACGCCAGCGGATGTAGAT
>probe:Drosophila_2:1639903_at:214:441; Interrogation_Position=483; Antisense; GATGTAGATGTCGTAATTTCCGGAT
>probe:Drosophila_2:1639903_at:504:265; Interrogation_Position=549; Antisense; CAGTACAACACCCTAAAGTCGATAA
>probe:Drosophila_2:1639903_at:150:219; Interrogation_Position=564; Antisense; AAGTCGATAACCAGGCAGCAGTGTG
>probe:Drosophila_2:1639903_at:671:511; Interrogation_Position=586; Antisense; GTGAGGAGCTGATCGATTTCGGATT
>probe:Drosophila_2:1639903_at:420:725; Interrogation_Position=610; Antisense; TTGAGGGCGAGCTGTGCCTGCTCCA
>probe:Drosophila_2:1639903_at:586:335; Interrogation_Position=629; Antisense; GCTCCACCAGGTGGACAATGGTGCT
>probe:Drosophila_2:1639903_at:5:251; Interrogation_Position=644; Antisense; CAATGGTGCTTGCAATGGCGATTCC
>probe:Drosophila_2:1639903_at:697:543; Interrogation_Position=722; Antisense; GGACGGATGTGGGTCCACCTACCCG
>probe:Drosophila_2:1639903_at:403:671; Interrogation_Position=741; Antisense; TACCCGGACGGATATGCCAGGGTCT
>probe:Drosophila_2:1639903_at:678:679; Interrogation_Position=753; Antisense; TATGCCAGGGTCTTTTACTTTAAGG
>probe:Drosophila_2:1639903_at:57:223; Interrogation_Position=774; Antisense; AAGGACTGGATCAAAAAGCACTCTG
>probe:Drosophila_2:1639903_at:101:209; Interrogation_Position=789; Antisense; AAGCACTCTGATGTCTAAGAATGTC
>probe:Drosophila_2:1639903_at:104:499; Interrogation_Position=801; Antisense; GTCTAAGAATGTCAAGCACGCAAAT

Paste this into a BLAST search page for me
TGTGGATACGCCAGCGGATGTAGATGATGTAGATGTCGTAATTTCCGGATCAGTACAACACCCTAAAGTCGATAAAAGTCGATAACCAGGCAGCAGTGTGGTGAGGAGCTGATCGATTTCGGATTTTGAGGGCGAGCTGTGCCTGCTCCAGCTCCACCAGGTGGACAATGGTGCTCAATGGTGCTTGCAATGGCGATTCCGGACGGATGTGGGTCCACCTACCCGTACCCGGACGGATATGCCAGGGTCTTATGCCAGGGTCTTTTACTTTAAGGAAGGACTGGATCAAAAAGCACTCTGAAGCACTCTGATGTCTAAGAATGTCGTCTAAGAATGTCAAGCACGCAAAT

Full Affymetrix probeset data:

Annotations for 1639903_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720