FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639904_at:

>probe:Drosophila_2:1639904_at:422:133; Interrogation_Position=115; Antisense; ACCCAGATTCGTTTGGTGCCACTAA
>probe:Drosophila_2:1639904_at:427:505; Interrogation_Position=130; Antisense; GTGCCACTAAAGGATCCGCCAAAGA
>probe:Drosophila_2:1639904_at:10:213; Interrogation_Position=151; Antisense; AAGACCATCCGATACAGTTTCCTGG
>probe:Drosophila_2:1639904_at:208:695; Interrogation_Position=168; Antisense; TTTCCTGGCGACCAAGTTCGGGCAG
>probe:Drosophila_2:1639904_at:216:661; Interrogation_Position=209; Antisense; TAAACCCAATATCCGGCGATTCGAA
>probe:Drosophila_2:1639904_at:447:87; Interrogation_Position=240; Antisense; AGTCGCAATTGGTGTGCTTCACTTC
>probe:Drosophila_2:1639904_at:159:533; Interrogation_Position=308; Antisense; GGTGGCCAAAATCCGAACTCTGGAA
>probe:Drosophila_2:1639904_at:11:329; Interrogation_Position=397; Antisense; GCGATTCCCATTGCCATCTATGGAA
>probe:Drosophila_2:1639904_at:340:403; Interrogation_Position=424; Antisense; GACTTCCAGCTGTCCGTATGGCGAG
>probe:Drosophila_2:1639904_at:187:583; Interrogation_Position=442; Antisense; TGGCGAGCTCTGGTGCATATGAAAC
>probe:Drosophila_2:1639904_at:384:57; Interrogation_Position=554; Antisense; ATGAGCTTGCTATCCTCATTCCGTG
>probe:Drosophila_2:1639904_at:519:505; Interrogation_Position=576; Antisense; GTGCCACCGAGTTGTGTCCCAAAAC
>probe:Drosophila_2:1639904_at:589:175; Interrogation_Position=598; Antisense; AACGGAGCTTCGAAGTACCACTGGG
>probe:Drosophila_2:1639904_at:575:209; Interrogation_Position=634; Antisense; AAGCAACTGCTTCTGGCCGATGAAA

Paste this into a BLAST search page for me
ACCCAGATTCGTTTGGTGCCACTAAGTGCCACTAAAGGATCCGCCAAAGAAAGACCATCCGATACAGTTTCCTGGTTTCCTGGCGACCAAGTTCGGGCAGTAAACCCAATATCCGGCGATTCGAAAGTCGCAATTGGTGTGCTTCACTTCGGTGGCCAAAATCCGAACTCTGGAAGCGATTCCCATTGCCATCTATGGAAGACTTCCAGCTGTCCGTATGGCGAGTGGCGAGCTCTGGTGCATATGAAACATGAGCTTGCTATCCTCATTCCGTGGTGCCACCGAGTTGTGTCCCAAAACAACGGAGCTTCGAAGTACCACTGGGAAGCAACTGCTTCTGGCCGATGAAA

Full Affymetrix probeset data:

Annotations for 1639904_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720