FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639905_at:

>probe:Drosophila_2:1639905_at:240:121; Interrogation_Position=1175; Antisense; AGCGATACATGTACGCCATCAACTC
>probe:Drosophila_2:1639905_at:198:71; Interrogation_Position=1202; Antisense; AGGCCCAAAGTGCACCCGGAATGAA
>probe:Drosophila_2:1639905_at:113:293; Interrogation_Position=1247; Antisense; CGTCGGGCATCTTTATTCGCAGAGA
>probe:Drosophila_2:1639905_at:125:317; Interrogation_Position=1274; Antisense; GCCTGGGCGGCAACTATATTTGCGT
>probe:Drosophila_2:1639905_at:475:465; Interrogation_Position=1332; Antisense; GATTGATCCGCAATATTTCGCCCAG
>probe:Drosophila_2:1639905_at:53:265; Interrogation_Position=1354; Antisense; CAGCACATCAGACCCCATTTGTATA
>probe:Drosophila_2:1639905_at:686:363; Interrogation_Position=1382; Antisense; GAATTCCCGTTCTTGGAGAAGCCCA
>probe:Drosophila_2:1639905_at:703:285; Interrogation_Position=1419; Antisense; CTGGGCGGGCTGCTATGATCATAAC
>probe:Drosophila_2:1639905_at:105:339; Interrogation_Position=1460; Antisense; GCATTTTAGGAGCTCACCCGTACTA
>probe:Drosophila_2:1639905_at:194:671; Interrogation_Position=1499; Antisense; TAGCCACCGGTTTTAGCGGACACGG
>probe:Drosophila_2:1639905_at:38:89; Interrogation_Position=1524; Antisense; AGTACAGCAATCTCTGGCCGTGGGC
>probe:Drosophila_2:1639905_at:297:595; Interrogation_Position=1544; Antisense; TGGGCCGAGCCATATCCGAGCTGAT
>probe:Drosophila_2:1639905_at:640:717; Interrogation_Position=1612; Antisense; TTCGACCGGCTGATTGTTGACCAAC
>probe:Drosophila_2:1639905_at:445:727; Interrogation_Position=1625; Antisense; TTGTTGACCAACCTATGTTCGAGTT

Paste this into a BLAST search page for me
AGCGATACATGTACGCCATCAACTCAGGCCCAAAGTGCACCCGGAATGAACGTCGGGCATCTTTATTCGCAGAGAGCCTGGGCGGCAACTATATTTGCGTGATTGATCCGCAATATTTCGCCCAGCAGCACATCAGACCCCATTTGTATAGAATTCCCGTTCTTGGAGAAGCCCACTGGGCGGGCTGCTATGATCATAACGCATTTTAGGAGCTCACCCGTACTATAGCCACCGGTTTTAGCGGACACGGAGTACAGCAATCTCTGGCCGTGGGCTGGGCCGAGCCATATCCGAGCTGATTTCGACCGGCTGATTGTTGACCAACTTGTTGACCAACCTATGTTCGAGTT

Full Affymetrix probeset data:

Annotations for 1639905_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720