FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639907_at:

>probe:Drosophila_2:1639907_at:708:341; Interrogation_Position=1888; Antisense; GCTTCTACCGTAGCTGGCGATCAGA
>probe:Drosophila_2:1639907_at:223:611; Interrogation_Position=1922; Antisense; TGACGAGGTTAACCCAGTGCCGCTG
>probe:Drosophila_2:1639907_at:254:327; Interrogation_Position=1957; Antisense; GCGTTGTGTACTGCACGGCGATCAA
>probe:Drosophila_2:1639907_at:281:19; Interrogation_Position=2005; Antisense; ATTTCCTGTGGACTCGGTACCAGAA
>probe:Drosophila_2:1639907_at:383:107; Interrogation_Position=2026; Antisense; AGAAGGCTAATGTGGCCACCGAAAA
>probe:Drosophila_2:1639907_at:271:7; Interrogation_Position=2065; Antisense; ATTCCCTGGGTTGTTCGCAGGAGGT
>probe:Drosophila_2:1639907_at:182:543; Interrogation_Position=2150; Antisense; GGATTCAACTTCTGTCTTTCAGGCG
>probe:Drosophila_2:1639907_at:165:277; Interrogation_Position=2165; Antisense; CTTTCAGGCGATTGCCGATTCGGAA
>probe:Drosophila_2:1639907_at:4:471; Interrogation_Position=2195; Antisense; GTTCCTTTTGGCCAAGAAGTACTTG
>probe:Drosophila_2:1639907_at:575:455; Interrogation_Position=2223; Antisense; GATAACGTGGACTCCATTTCCAAGT
>probe:Drosophila_2:1639907_at:126:217; Interrogation_Position=2244; Antisense; AAGTTCTACCATCCTCAGTCAGAAT
>probe:Drosophila_2:1639907_at:253:367; Interrogation_Position=2265; Antisense; GAATCTATGTCTGAACTTCTGCCGC
>probe:Drosophila_2:1639907_at:249:579; Interrogation_Position=2345; Antisense; GGCCAGTTCCAAGGATCAGCTCAAG
>probe:Drosophila_2:1639907_at:287:101; Interrogation_Position=2443; Antisense; AGAGGTTCACTCGAGCCATCAGTAA

Paste this into a BLAST search page for me
GCTTCTACCGTAGCTGGCGATCAGATGACGAGGTTAACCCAGTGCCGCTGGCGTTGTGTACTGCACGGCGATCAAATTTCCTGTGGACTCGGTACCAGAAAGAAGGCTAATGTGGCCACCGAAAAATTCCCTGGGTTGTTCGCAGGAGGTGGATTCAACTTCTGTCTTTCAGGCGCTTTCAGGCGATTGCCGATTCGGAAGTTCCTTTTGGCCAAGAAGTACTTGGATAACGTGGACTCCATTTCCAAGTAAGTTCTACCATCCTCAGTCAGAATGAATCTATGTCTGAACTTCTGCCGCGGCCAGTTCCAAGGATCAGCTCAAGAGAGGTTCACTCGAGCCATCAGTAA

Full Affymetrix probeset data:

Annotations for 1639907_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720