Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639909_at:

>probe:Drosophila_2:1639909_at:158:201; Interrogation_Position=3832; Antisense; AACCATTTGGCGGACACTTTATGTA
>probe:Drosophila_2:1639909_at:313:15; Interrogation_Position=3911; Antisense; ATTTTTTCTGTTTGTGGTCCACTTG
>probe:Drosophila_2:1639909_at:717:691; Interrogation_Position=3921; Antisense; TTTGTGGTCCACTTGTGGCATAGGT
>probe:Drosophila_2:1639909_at:421:583; Interrogation_Position=3936; Antisense; TGGCATAGGTTGGATGTACACATAT
>probe:Drosophila_2:1639909_at:135:491; Interrogation_Position=3951; Antisense; GTACACATATATTCCGATGACGGGT
>probe:Drosophila_2:1639909_at:394:365; Interrogation_Position=3981; Antisense; GAATCTAGTCCTTTGGAAATGCCAA
>probe:Drosophila_2:1639909_at:134:457; Interrogation_Position=4055; Antisense; GATACCAATGTTTTCGGTTCACCGA
>probe:Drosophila_2:1639909_at:684:537; Interrogation_Position=4070; Antisense; GGTTCACCGAAGATTGTGGTCTACA
>probe:Drosophila_2:1639909_at:586:465; Interrogation_Position=4081; Antisense; GATTGTGGTCTACACTATTGTAAAC
>probe:Drosophila_2:1639909_at:3:191; Interrogation_Position=4147; Antisense; AACTAGACTATTTACCACGTGACGT
>probe:Drosophila_2:1639909_at:642:127; Interrogation_Position=4160; Antisense; ACCACGTGACGTATCCTCAAAAGGT
>probe:Drosophila_2:1639909_at:142:633; Interrogation_Position=4198; Antisense; TCGACGGATTTTATGTATGACAGCA
>probe:Drosophila_2:1639909_at:674:399; Interrogation_Position=4216; Antisense; GACAGCAGCGTATTTTTTCATTCGA
>probe:Drosophila_2:1639909_at:269:189; Interrogation_Position=4337; Antisense; AACATATCACAACCTAACTCTTTTT

Paste this into a BLAST search page for me
AACCATTTGGCGGACACTTTATGTAATTTTTTCTGTTTGTGGTCCACTTGTTTGTGGTCCACTTGTGGCATAGGTTGGCATAGGTTGGATGTACACATATGTACACATATATTCCGATGACGGGTGAATCTAGTCCTTTGGAAATGCCAAGATACCAATGTTTTCGGTTCACCGAGGTTCACCGAAGATTGTGGTCTACAGATTGTGGTCTACACTATTGTAAACAACTAGACTATTTACCACGTGACGTACCACGTGACGTATCCTCAAAAGGTTCGACGGATTTTATGTATGACAGCAGACAGCAGCGTATTTTTTCATTCGAAACATATCACAACCTAACTCTTTTT

Full Affymetrix probeset data:

Annotations for 1639909_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime