Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639911_at:

>probe:Drosophila_2:1639911_at:582:285; Interrogation_Position=423; Antisense; CTGGTCGTGGGCATTATCTACAATC
>probe:Drosophila_2:1639911_at:629:15; Interrogation_Position=435; Antisense; ATTATCTACAATCCACCGGCGAATG
>probe:Drosophila_2:1639911_at:541:369; Interrogation_Position=455; Antisense; GAATGAACTATTCTCCGCCTACAAG
>probe:Drosophila_2:1639911_at:239:251; Interrogation_Position=476; Antisense; CAAGGGACACGGAGCCTATCTGAAT
>probe:Drosophila_2:1639911_at:363:115; Interrogation_Position=542; Antisense; AGCAGTGATTGCCTACGAGATCTCC
>probe:Drosophila_2:1639911_at:313:215; Interrogation_Position=615; Antisense; AAGATGGCCTCGAATGCCACGGGAA
>probe:Drosophila_2:1639911_at:66:379; Interrogation_Position=637; Antisense; GAACCAGGTGTTTCGGAAGTGCCGC
>probe:Drosophila_2:1639911_at:100:579; Interrogation_Position=687; Antisense; GGCCAGTGCGATGCCTATCATGTGG
>probe:Drosophila_2:1639911_at:270:285; Interrogation_Position=717; Antisense; CTGAAACCGTGGGACATTGCTGCCG
>probe:Drosophila_2:1639911_at:646:415; Interrogation_Position=742; Antisense; GAGCCATCATTCTGACCGAAGCTGG
>probe:Drosophila_2:1639911_at:690:595; Interrogation_Position=773; Antisense; TGTGTGCCATACCAGCGGATCCAAA
>probe:Drosophila_2:1639911_at:475:445; Interrogation_Position=806; Antisense; GATGAAACCGGATTGCGTGTGCGCC
>probe:Drosophila_2:1639911_at:42:439; Interrogation_Position=873; Antisense; GAGGCCGGTCAGATTACAGAGTACA
>probe:Drosophila_2:1639911_at:116:657; Interrogation_Position=969; Antisense; TAATCGCGCAGATATTCCAGTACAA

Paste this into a BLAST search page for me
CTGGTCGTGGGCATTATCTACAATCATTATCTACAATCCACCGGCGAATGGAATGAACTATTCTCCGCCTACAAGCAAGGGACACGGAGCCTATCTGAATAGCAGTGATTGCCTACGAGATCTCCAAGATGGCCTCGAATGCCACGGGAAGAACCAGGTGTTTCGGAAGTGCCGCGGCCAGTGCGATGCCTATCATGTGGCTGAAACCGTGGGACATTGCTGCCGGAGCCATCATTCTGACCGAAGCTGGTGTGTGCCATACCAGCGGATCCAAAGATGAAACCGGATTGCGTGTGCGCCGAGGCCGGTCAGATTACAGAGTACATAATCGCGCAGATATTCCAGTACAA

Full Affymetrix probeset data:

Annotations for 1639911_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime