Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639913_at:

>probe:Drosophila_2:1639913_at:314:105; Interrogation_Position=2867; Antisense; AGAACCTCCGAGCAAACTGGCGTTT
>probe:Drosophila_2:1639913_at:264:457; Interrogation_Position=2906; Antisense; GATACTCAACTTATCGCAGGATGAT
>probe:Drosophila_2:1639913_at:310:547; Interrogation_Position=2924; Antisense; GGATGATGACTACCACTACACTCTA
>probe:Drosophila_2:1639913_at:564:175; Interrogation_Position=2966; Antisense; AAACGGTTAGCCATAGTGACACTTT
>probe:Drosophila_2:1639913_at:381:511; Interrogation_Position=2981; Antisense; GTGACACTTTTGGTTTACTTGAGCA
>probe:Drosophila_2:1639913_at:666:135; Interrogation_Position=3025; Antisense; ACTTGGAAAGCGCTAAACGTCTTAG
>probe:Drosophila_2:1639913_at:134:175; Interrogation_Position=3071; Antisense; AAACCACTAAATGAGGCATGCCTGT
>probe:Drosophila_2:1639913_at:627:185; Interrogation_Position=3120; Antisense; AACACAATCGCTGAAAGTTGCAACG
>probe:Drosophila_2:1639913_at:730:427; Interrogation_Position=3136; Antisense; GTTGCAACGATAGCCGTTAGTCGAT
>probe:Drosophila_2:1639913_at:562:301; Interrogation_Position=3237; Antisense; CCGCAGTTCTCCCTTAGAGTTTAAG
>probe:Drosophila_2:1639913_at:283:465; Interrogation_Position=3273; Antisense; GTTGTAAGACTGTTTGCTACCCTAA
>probe:Drosophila_2:1639913_at:173:339; Interrogation_Position=3288; Antisense; GCTACCCTAAAATTCTCGCCTGAAA
>probe:Drosophila_2:1639913_at:387:273; Interrogation_Position=3320; Antisense; CTTGTTCCGGGAAAATTACACAGCA
>probe:Drosophila_2:1639913_at:65:187; Interrogation_Position=3345; Antisense; AACACTTTTCTGCTTTTGTCCTACT

Paste this into a BLAST search page for me
AGAACCTCCGAGCAAACTGGCGTTTGATACTCAACTTATCGCAGGATGATGGATGATGACTACCACTACACTCTAAAACGGTTAGCCATAGTGACACTTTGTGACACTTTTGGTTTACTTGAGCAACTTGGAAAGCGCTAAACGTCTTAGAAACCACTAAATGAGGCATGCCTGTAACACAATCGCTGAAAGTTGCAACGGTTGCAACGATAGCCGTTAGTCGATCCGCAGTTCTCCCTTAGAGTTTAAGGTTGTAAGACTGTTTGCTACCCTAAGCTACCCTAAAATTCTCGCCTGAAACTTGTTCCGGGAAAATTACACAGCAAACACTTTTCTGCTTTTGTCCTACT

Full Affymetrix probeset data:

Annotations for 1639913_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime