FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639914_at:

>probe:Drosophila_2:1639914_at:320:93; Interrogation_Position=1104; Antisense; AGCTTCCAGGATCAGTTCTACCGTC
>probe:Drosophila_2:1639914_at:603:131; Interrogation_Position=1123; Antisense; ACCGTCCTGTGCAACTGGTGGAGTA
>probe:Drosophila_2:1639914_at:614:519; Interrogation_Position=1140; Antisense; GTGGAGTACTATCGCTACATTCGCT
>probe:Drosophila_2:1639914_at:324:57; Interrogation_Position=1188; Antisense; ATGATGACGACTGCCGATGAGCCGG
>probe:Drosophila_2:1639914_at:46:417; Interrogation_Position=1206; Antisense; GAGCCGGCGCAAGGTGTATCCAAAC
>probe:Drosophila_2:1639914_at:449:341; Interrogation_Position=1273; Antisense; GCTATCGTCTCTTCGGGAGCACAGT
>probe:Drosophila_2:1639914_at:428:153; Interrogation_Position=1293; Antisense; ACAGTCACTCTGGTGCTGCAAAAGT
>probe:Drosophila_2:1639914_at:380:55; Interrogation_Position=1375; Antisense; ATGAGGACTCCTCACAGTTCCTGAT
>probe:Drosophila_2:1639914_at:660:439; Interrogation_Position=1432; Antisense; GATGCGCCCAGTTGGTTTGGTCACA
>probe:Drosophila_2:1639914_at:657:727; Interrogation_Position=1448; Antisense; TTGGTCACATTACACGCTCGTGCAG
>probe:Drosophila_2:1639914_at:302:223; Interrogation_Position=1482; Antisense; AAGGTGGACATCAGCTCCGAGTTCG
>probe:Drosophila_2:1639914_at:129:283; Interrogation_Position=1499; Antisense; CGAGTTCGATTTGACCGAGGCCAAA
>probe:Drosophila_2:1639914_at:152:163; Interrogation_Position=1521; Antisense; AAATATCCGGCGCTGAGGTTCTCAA
>probe:Drosophila_2:1639914_at:141:335; Interrogation_Position=1569; Antisense; GCTGATGCACCATTGGCTTAGGTTA

Paste this into a BLAST search page for me
AGCTTCCAGGATCAGTTCTACCGTCACCGTCCTGTGCAACTGGTGGAGTAGTGGAGTACTATCGCTACATTCGCTATGATGACGACTGCCGATGAGCCGGGAGCCGGCGCAAGGTGTATCCAAACGCTATCGTCTCTTCGGGAGCACAGTACAGTCACTCTGGTGCTGCAAAAGTATGAGGACTCCTCACAGTTCCTGATGATGCGCCCAGTTGGTTTGGTCACATTGGTCACATTACACGCTCGTGCAGAAGGTGGACATCAGCTCCGAGTTCGCGAGTTCGATTTGACCGAGGCCAAAAAATATCCGGCGCTGAGGTTCTCAAGCTGATGCACCATTGGCTTAGGTTA

Full Affymetrix probeset data:

Annotations for 1639914_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720