FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639915_at:

>probe:Drosophila_2:1639915_at:231:395; Interrogation_Position=1023; Antisense; GAAATCGGTTACCATCCATCAGTCC
>probe:Drosophila_2:1639915_at:529:687; Interrogation_Position=488; Antisense; TATTTGCGCGGGACAAGTGGCTATC
>probe:Drosophila_2:1639915_at:572:555; Interrogation_Position=568; Antisense; GGACGCGACCAGGATCTTGGATTCT
>probe:Drosophila_2:1639915_at:115:37; Interrogation_Position=581; Antisense; ATCTTGGATTCTGGCACGATGTGCA
>probe:Drosophila_2:1639915_at:4:113; Interrogation_Position=659; Antisense; AGCACGTGACCGGTGACCAGATGAT
>probe:Drosophila_2:1639915_at:711:267; Interrogation_Position=687; Antisense; CAGGGTGTGCCTGGTCAAATCGCTG
>probe:Drosophila_2:1639915_at:15:167; Interrogation_Position=703; Antisense; AAATCGCTGGATCTGTACACCGAGC
>probe:Drosophila_2:1639915_at:679:217; Interrogation_Position=742; Antisense; AAGTCTCGTTCGCTATTCGAGCTAA
>probe:Drosophila_2:1639915_at:340:521; Interrogation_Position=799; Antisense; GTGGCCTACTTTGATGTCGGATTCA
>probe:Drosophila_2:1639915_at:646:561; Interrogation_Position=881; Antisense; GGAACCAAACGGTCTTCTATCTGGA
>probe:Drosophila_2:1639915_at:170:587; Interrogation_Position=902; Antisense; TGGAGACACCACTGCCTGTTAGGGC
>probe:Drosophila_2:1639915_at:400:269; Interrogation_Position=936; Antisense; CATCAAGGGCGTGCTCACCATGAAA
>probe:Drosophila_2:1639915_at:631:437; Interrogation_Position=967; Antisense; GAGGACAGCATCTTTGACACGGAAT
>probe:Drosophila_2:1639915_at:120:701; Interrogation_Position=998; Antisense; TTTTTGTGAACTTCGATGGCCGTGA

Paste this into a BLAST search page for me
GAAATCGGTTACCATCCATCAGTCCTATTTGCGCGGGACAAGTGGCTATCGGACGCGACCAGGATCTTGGATTCTATCTTGGATTCTGGCACGATGTGCAAGCACGTGACCGGTGACCAGATGATCAGGGTGTGCCTGGTCAAATCGCTGAAATCGCTGGATCTGTACACCGAGCAAGTCTCGTTCGCTATTCGAGCTAAGTGGCCTACTTTGATGTCGGATTCAGGAACCAAACGGTCTTCTATCTGGATGGAGACACCACTGCCTGTTAGGGCCATCAAGGGCGTGCTCACCATGAAAGAGGACAGCATCTTTGACACGGAATTTTTTGTGAACTTCGATGGCCGTGA

Full Affymetrix probeset data:

Annotations for 1639915_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720