FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639916_at:

>probe:Drosophila_2:1639916_at:488:225; Interrogation_Position=1055; Antisense; AAGGAGCGCATGTCCAAGCGGCAGA
>probe:Drosophila_2:1639916_at:110:563; Interrogation_Position=1081; Antisense; GGAACTGTACGTACACTTCCTGCAG
>probe:Drosophila_2:1639916_at:609:711; Interrogation_Position=1115; Antisense; TTCATCAACGATCACCGTCGCAATG
>probe:Drosophila_2:1639916_at:529:373; Interrogation_Position=1225; Antisense; GAAGCAGACCTTCGACAACTGGCGA
>probe:Drosophila_2:1639916_at:57:581; Interrogation_Position=1244; Antisense; TGGCGATACCGGATCTTCCTTTACG
>probe:Drosophila_2:1639916_at:244:323; Interrogation_Position=1268; Antisense; GCGCGCTACAACTCTAAGCTGCAGG
>probe:Drosophila_2:1639916_at:399:367; Interrogation_Position=1306; Antisense; GAATCCGCGAAACTTCAAGCCGCTG
>probe:Drosophila_2:1639916_at:462:665; Interrogation_Position=1352; Antisense; TACATCATGTGGATCCGGAACCCGG
>probe:Drosophila_2:1639916_at:229:397; Interrogation_Position=1397; Antisense; GACAAGATGCGCAATGTCTTCTGCA
>probe:Drosophila_2:1639916_at:67:61; Interrogation_Position=1410; Antisense; ATGTCTTCTGCAATCTGGAGGAGTC
>probe:Drosophila_2:1639916_at:160:89; Interrogation_Position=1449; Antisense; AGTAGATAGCCGTACATCCGTCGTA
>probe:Drosophila_2:1639916_at:353:45; Interrogation_Position=1464; Antisense; ATCCGTCGTAGCTCTAACATTTCAA
>probe:Drosophila_2:1639916_at:249:239; Interrogation_Position=1488; Antisense; AATCTTCTTTGTCCTCTTTTCAATG
>probe:Drosophila_2:1639916_at:519:479; Interrogation_Position=1513; Antisense; GTTTCTATCGTGTTAGTCGTGCGTA

Paste this into a BLAST search page for me
AAGGAGCGCATGTCCAAGCGGCAGAGGAACTGTACGTACACTTCCTGCAGTTCATCAACGATCACCGTCGCAATGGAAGCAGACCTTCGACAACTGGCGATGGCGATACCGGATCTTCCTTTACGGCGCGCTACAACTCTAAGCTGCAGGGAATCCGCGAAACTTCAAGCCGCTGTACATCATGTGGATCCGGAACCCGGGACAAGATGCGCAATGTCTTCTGCAATGTCTTCTGCAATCTGGAGGAGTCAGTAGATAGCCGTACATCCGTCGTAATCCGTCGTAGCTCTAACATTTCAAAATCTTCTTTGTCCTCTTTTCAATGGTTTCTATCGTGTTAGTCGTGCGTA

Full Affymetrix probeset data:

Annotations for 1639916_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720