FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639918_at:

>probe:Drosophila_2:1639918_at:662:515; Interrogation_Position=1013; Antisense; GTGTCTACTTTCTGGACTTCGGCAT
>probe:Drosophila_2:1639918_at:489:395; Interrogation_Position=1117; Antisense; GAAATATTGGGAACACGCCGTCAGT
>probe:Drosophila_2:1639918_at:624:495; Interrogation_Position=1136; Antisense; GTCAGTGTCCCATACCTTACATAAA
>probe:Drosophila_2:1639918_at:290:553; Interrogation_Position=1185; Antisense; GGAGCACACAGTACTACGAAGCGAT
>probe:Drosophila_2:1639918_at:124:373; Interrogation_Position=757; Antisense; GAAGTGGCCAAATCTTTTGCACGAT
>probe:Drosophila_2:1639918_at:397:459; Interrogation_Position=779; Antisense; GATATAGACCCAAGCGTCGCGAACG
>probe:Drosophila_2:1639918_at:265:519; Interrogation_Position=803; Antisense; GTGGTAGCATTGTACGCGTCCATGT
>probe:Drosophila_2:1639918_at:195:329; Interrogation_Position=818; Antisense; GCGTCCATGTCACCAGGATCGTTAG
>probe:Drosophila_2:1639918_at:598:545; Interrogation_Position=833; Antisense; GGATCGTTAGCCATGCCGAATTCTA
>probe:Drosophila_2:1639918_at:636:11; Interrogation_Position=852; Antisense; ATTCTACGCCCGATTCGCTGATGGA
>probe:Drosophila_2:1639918_at:330:605; Interrogation_Position=870; Antisense; TGATGGACCAACAGTGCCCACGTGG
>probe:Drosophila_2:1639918_at:132:155; Interrogation_Position=919; Antisense; ACAGGTGATTTTCGCGTCTGGGACA
>probe:Drosophila_2:1639918_at:367:21; Interrogation_Position=969; Antisense; ATATCATCGCGCCAAAATCGTTGAC
>probe:Drosophila_2:1639918_at:211:237; Interrogation_Position=984; Antisense; AATCGTTGACATATTTCGCTGCCGT

Paste this into a BLAST search page for me
GTGTCTACTTTCTGGACTTCGGCATGAAATATTGGGAACACGCCGTCAGTGTCAGTGTCCCATACCTTACATAAAGGAGCACACAGTACTACGAAGCGATGAAGTGGCCAAATCTTTTGCACGATGATATAGACCCAAGCGTCGCGAACGGTGGTAGCATTGTACGCGTCCATGTGCGTCCATGTCACCAGGATCGTTAGGGATCGTTAGCCATGCCGAATTCTAATTCTACGCCCGATTCGCTGATGGATGATGGACCAACAGTGCCCACGTGGACAGGTGATTTTCGCGTCTGGGACAATATCATCGCGCCAAAATCGTTGACAATCGTTGACATATTTCGCTGCCGT

Full Affymetrix probeset data:

Annotations for 1639918_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720