FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639923_at:

>probe:Drosophila_2:1639923_at:494:339; Interrogation_Position=1005; Antisense; GCTACGATATGATGCACTACTACCT
>probe:Drosophila_2:1639923_at:105:669; Interrogation_Position=1022; Antisense; TACTACCTGCACTATGGGAACCCTT
>probe:Drosophila_2:1639923_at:678:355; Interrogation_Position=1039; Antisense; GAACCCTTCGCTATGGGCCTTTGTA
>probe:Drosophila_2:1639923_at:660:521; Interrogation_Position=1053; Antisense; GGGCCTTTGTACACATGAAGCGCTA
>probe:Drosophila_2:1639923_at:547:177; Interrogation_Position=1104; Antisense; AAACTCTCGGTTACGGCATCAGCAG
>probe:Drosophila_2:1639923_at:398:633; Interrogation_Position=1129; Antisense; TCCCTTGTGGGATGTCGTCTTCAAA
>probe:Drosophila_2:1639923_at:270:177; Interrogation_Position=1152; Antisense; AAACGAGAATCCATCTCCGCAAGCT
>probe:Drosophila_2:1639923_at:604:119; Interrogation_Position=1173; Antisense; AGCTGAGATACCAACTGCGCTGGTC
>probe:Drosophila_2:1639923_at:221:625; Interrogation_Position=1188; Antisense; TGCGCTGGTCCTAGCTGCAATAAAT
>probe:Drosophila_2:1639923_at:227:337; Interrogation_Position=1270; Antisense; GCTGCCGCAGCAAATAGTTCAATCA
>probe:Drosophila_2:1639923_at:123:59; Interrogation_Position=845; Antisense; ATGATCCATGGCCTGCACCACAAGG
>probe:Drosophila_2:1639923_at:45:293; Interrogation_Position=877; Antisense; CGATCCGATGCGACTGGTGTTTCCG
>probe:Drosophila_2:1639923_at:360:85; Interrogation_Position=970; Antisense; AGTGATCTTGTCTGGAGCTCTGGCC
>probe:Drosophila_2:1639923_at:573:581; Interrogation_Position=990; Antisense; TGGCCGGCTATCTGTGCTACGATAT

Paste this into a BLAST search page for me
GCTACGATATGATGCACTACTACCTTACTACCTGCACTATGGGAACCCTTGAACCCTTCGCTATGGGCCTTTGTAGGGCCTTTGTACACATGAAGCGCTAAAACTCTCGGTTACGGCATCAGCAGTCCCTTGTGGGATGTCGTCTTCAAAAAACGAGAATCCATCTCCGCAAGCTAGCTGAGATACCAACTGCGCTGGTCTGCGCTGGTCCTAGCTGCAATAAATGCTGCCGCAGCAAATAGTTCAATCAATGATCCATGGCCTGCACCACAAGGCGATCCGATGCGACTGGTGTTTCCGAGTGATCTTGTCTGGAGCTCTGGCCTGGCCGGCTATCTGTGCTACGATAT

Full Affymetrix probeset data:

Annotations for 1639923_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720