FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639925_at:

>probe:Drosophila_2:1639925_at:232:385; Interrogation_Position=134; Antisense; GAACTTTCAAGGTGCTGGCGGCCAT
>probe:Drosophila_2:1639925_at:724:683; Interrogation_Position=158; Antisense; TATCGGGTATACTCTTCATGGGCTA
>probe:Drosophila_2:1639925_at:77:65; Interrogation_Position=175; Antisense; ATGGGCTATTGCGTATATTTCGACA
>probe:Drosophila_2:1639925_at:670:199; Interrogation_Position=254; Antisense; AACGCTCATTGGCATCCGTGAAGTC
>probe:Drosophila_2:1639925_at:690:141; Interrogation_Position=280; Antisense; ACGGCATCGGTTTCCATGAGCGAGC
>probe:Drosophila_2:1639925_at:99:373; Interrogation_Position=313; Antisense; GAAGTGTACTTCATGACCCAGATAC
>probe:Drosophila_2:1639925_at:690:423; Interrogation_Position=346; Antisense; GAGACCCTGATCACAAACGGCGATG
>probe:Drosophila_2:1639925_at:392:69; Interrogation_Position=374; Antisense; AGGCCGGCGTGGAGCATCTAATCAA
>probe:Drosophila_2:1639925_at:625:653; Interrogation_Position=392; Antisense; TAATCAACGCGATACTCGTCTGCGG
>probe:Drosophila_2:1639925_at:609:579; Interrogation_Position=415; Antisense; GGCCAGCCGTCAAAACTGTTGCAGT
>probe:Drosophila_2:1639925_at:384:195; Interrogation_Position=428; Antisense; AACTGTTGCAGTTGCTCCAGAGCAC
>probe:Drosophila_2:1639925_at:307:113; Interrogation_Position=448; Antisense; AGCACCTTGCCCATGGATATTTTCA
>probe:Drosophila_2:1639925_at:198:605; Interrogation_Position=482; Antisense; TGATCAAGATGCACGCCTACGAGGC
>probe:Drosophila_2:1639925_at:438:157; Interrogation_Position=571; Antisense; AAATTGATGGTCTCTGTTTTTTCTC

Paste this into a BLAST search page for me
GAACTTTCAAGGTGCTGGCGGCCATTATCGGGTATACTCTTCATGGGCTAATGGGCTATTGCGTATATTTCGACAAACGCTCATTGGCATCCGTGAAGTCACGGCATCGGTTTCCATGAGCGAGCGAAGTGTACTTCATGACCCAGATACGAGACCCTGATCACAAACGGCGATGAGGCCGGCGTGGAGCATCTAATCAATAATCAACGCGATACTCGTCTGCGGGGCCAGCCGTCAAAACTGTTGCAGTAACTGTTGCAGTTGCTCCAGAGCACAGCACCTTGCCCATGGATATTTTCATGATCAAGATGCACGCCTACGAGGCAAATTGATGGTCTCTGTTTTTTCTC

Full Affymetrix probeset data:

Annotations for 1639925_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720