FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639926_at:

>probe:Drosophila_2:1639926_at:369:371; Interrogation_Position=1850; Antisense; GAAGGCGCTATAAGCTGCATCCTCA
>probe:Drosophila_2:1639926_at:13:377; Interrogation_Position=1875; Antisense; GAAGCAACGATCCAAGTACATCTGT
>probe:Drosophila_2:1639926_at:18:209; Interrogation_Position=1907; Antisense; AAGCAGTTGTCGAGGCGGGCAACCA
>probe:Drosophila_2:1639926_at:716:323; Interrogation_Position=1921; Antisense; GCGGGCAACCACTTCGTGTGGGAAT
>probe:Drosophila_2:1639926_at:198:725; Interrogation_Position=1946; Antisense; TTGCACCTGGCAAGGGATCCCTCAA
>probe:Drosophila_2:1639926_at:254:649; Interrogation_Position=1967; Antisense; TCAACGTACCGCCAAAGGAGGCCAT
>probe:Drosophila_2:1639926_at:701:269; Interrogation_Position=1989; Antisense; CATCCTGCAGCATTATCGGGTTTGT
>probe:Drosophila_2:1639926_at:531:363; Interrogation_Position=2014; Antisense; GAATTCGGTGGCAACGACTGCATCA
>probe:Drosophila_2:1639926_at:342:33; Interrogation_Position=2035; Antisense; ATCAAGGCTCCTTCGATTGTAGATC
>probe:Drosophila_2:1639926_at:615:217; Interrogation_Position=2071; Antisense; AAGTATGTGAATCGCTTGGTACAGC
>probe:Drosophila_2:1639926_at:74:527; Interrogation_Position=2261; Antisense; GGGCAACGAAGCAGCAGCAATCCAT
>probe:Drosophila_2:1639926_at:533:209; Interrogation_Position=2323; Antisense; AAGCAATCGATTCCATCGGCCAATG
>probe:Drosophila_2:1639926_at:334:141; Interrogation_Position=2358; Antisense; ACGGAAGCTGATTGTCTTTGAGATC
>probe:Drosophila_2:1639926_at:221:97; Interrogation_Position=2378; Antisense; AGATCAATGATTTGGGCGTGCCCGT

Paste this into a BLAST search page for me
GAAGGCGCTATAAGCTGCATCCTCAGAAGCAACGATCCAAGTACATCTGTAAGCAGTTGTCGAGGCGGGCAACCAGCGGGCAACCACTTCGTGTGGGAATTTGCACCTGGCAAGGGATCCCTCAATCAACGTACCGCCAAAGGAGGCCATCATCCTGCAGCATTATCGGGTTTGTGAATTCGGTGGCAACGACTGCATCAATCAAGGCTCCTTCGATTGTAGATCAAGTATGTGAATCGCTTGGTACAGCGGGCAACGAAGCAGCAGCAATCCATAAGCAATCGATTCCATCGGCCAATGACGGAAGCTGATTGTCTTTGAGATCAGATCAATGATTTGGGCGTGCCCGT

Full Affymetrix probeset data:

Annotations for 1639926_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720