FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639927_at:

>probe:Drosophila_2:1639927_at:462:671; Interrogation_Position=1011; Antisense; TAGCTGTTGCTGTTCTTTCATAAAG
>probe:Drosophila_2:1639927_at:727:685; Interrogation_Position=1041; Antisense; TATACCATTTGCACTCCTAGGAGAT
>probe:Drosophila_2:1639927_at:108:165; Interrogation_Position=1077; Antisense; AAATACCTGCTCAATCTTTGCCATT
>probe:Drosophila_2:1639927_at:531:53; Interrogation_Position=1102; Antisense; ATGATATCAATCTCGGATCCTTGGT
>probe:Drosophila_2:1639927_at:309:449; Interrogation_Position=1117; Antisense; GATCCTTGGTCCTGGTGGCTGATTG
>probe:Drosophila_2:1639927_at:512:571; Interrogation_Position=1133; Antisense; GGCTGATTGTCGGTGCCCAAGTGAC
>probe:Drosophila_2:1639927_at:498:443; Interrogation_Position=1174; Antisense; GATGTAGGAATGGTCGCGCCGCCAC
>probe:Drosophila_2:1639927_at:237:529; Interrogation_Position=1235; Antisense; GGGATGCCTGTTTGGCCTTCAGAGC
>probe:Drosophila_2:1639927_at:226:103; Interrogation_Position=1255; Antisense; AGAGCCGACGTCAGTTCGATTTGCA
>probe:Drosophila_2:1639927_at:425:21; Interrogation_Position=1360; Antisense; ATATAGTCACCTTCTTTTCCAGTTC
>probe:Drosophila_2:1639927_at:533:123; Interrogation_Position=1430; Antisense; AGCGCTACCGCTCAGATTGCGTATT
>probe:Drosophila_2:1639927_at:513:5; Interrogation_Position=1445; Antisense; ATTGCGTATTTGTGCCAGGGTTTCC
>probe:Drosophila_2:1639927_at:517:697; Interrogation_Position=968; Antisense; TTTCATTCGAGGCTACACTATCCAC
>probe:Drosophila_2:1639927_at:638:683; Interrogation_Position=986; Antisense; TATCCACACACTACTAGCTGTCTGT

Paste this into a BLAST search page for me
TAGCTGTTGCTGTTCTTTCATAAAGTATACCATTTGCACTCCTAGGAGATAAATACCTGCTCAATCTTTGCCATTATGATATCAATCTCGGATCCTTGGTGATCCTTGGTCCTGGTGGCTGATTGGGCTGATTGTCGGTGCCCAAGTGACGATGTAGGAATGGTCGCGCCGCCACGGGATGCCTGTTTGGCCTTCAGAGCAGAGCCGACGTCAGTTCGATTTGCAATATAGTCACCTTCTTTTCCAGTTCAGCGCTACCGCTCAGATTGCGTATTATTGCGTATTTGTGCCAGGGTTTCCTTTCATTCGAGGCTACACTATCCACTATCCACACACTACTAGCTGTCTGT

Full Affymetrix probeset data:

Annotations for 1639927_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720