FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639931_at:

>probe:Drosophila_2:1639931_at:519:465; Interrogation_Position=1007; Antisense; GATTGGTGGACGTCAACTATCGCCA
>probe:Drosophila_2:1639931_at:3:653; Interrogation_Position=1019; Antisense; TCAACTATCGCCAGGTCCATAAGCT
>probe:Drosophila_2:1639931_at:688:723; Interrogation_Position=1056; Antisense; TTGAGTTTCGTTTCGTTTACGCTGT
>probe:Drosophila_2:1639931_at:454:471; Interrogation_Position=1093; Antisense; GTTCGTTTTCGAAGTGCTTTTCTTG
>probe:Drosophila_2:1639931_at:11:563; Interrogation_Position=563; Antisense; GGAATCGCAAGGAGGCCAACCGGCA
>probe:Drosophila_2:1639931_at:499:215; Interrogation_Position=658; Antisense; AAGATCAATGCTATTGTCCTGGCCG
>probe:Drosophila_2:1639931_at:300:143; Interrogation_Position=707; Antisense; ACTTCTGGGCGGAGCTCTTCGGACT
>probe:Drosophila_2:1639931_at:28:717; Interrogation_Position=751; Antisense; TTCGTGGTAGCCTTCATTCTGCAGA
>probe:Drosophila_2:1639931_at:468:11; Interrogation_Position=766; Antisense; ATTCTGCAGAGCTACCGATTTGTCC
>probe:Drosophila_2:1639931_at:531:459; Interrogation_Position=782; Antisense; GATTTGTCCTCTACTCCCTGGTGAA
>probe:Drosophila_2:1639931_at:674:589; Interrogation_Position=800; Antisense; TGGTGAACACCCTGATCGTTGGACT
>probe:Drosophila_2:1639931_at:378:127; Interrogation_Position=890; Antisense; AGCCACCACTGATTTTCCTATACAA
>probe:Drosophila_2:1639931_at:331:687; Interrogation_Position=908; Antisense; TATACAATGTACTGTGCTCCGCCAG
>probe:Drosophila_2:1639931_at:156:187; Interrogation_Position=964; Antisense; AACAACTTGATGAAACCGCTGGCCA

Paste this into a BLAST search page for me
GATTGGTGGACGTCAACTATCGCCATCAACTATCGCCAGGTCCATAAGCTTTGAGTTTCGTTTCGTTTACGCTGTGTTCGTTTTCGAAGTGCTTTTCTTGGGAATCGCAAGGAGGCCAACCGGCAAAGATCAATGCTATTGTCCTGGCCGACTTCTGGGCGGAGCTCTTCGGACTTTCGTGGTAGCCTTCATTCTGCAGAATTCTGCAGAGCTACCGATTTGTCCGATTTGTCCTCTACTCCCTGGTGAATGGTGAACACCCTGATCGTTGGACTAGCCACCACTGATTTTCCTATACAATATACAATGTACTGTGCTCCGCCAGAACAACTTGATGAAACCGCTGGCCA

Full Affymetrix probeset data:

Annotations for 1639931_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720