FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639932_at:

>probe:Drosophila_2:1639932_at:118:161; Interrogation_Position=1006; Antisense; ACAATGCATTTTCTGGCGCATCCAT
>probe:Drosophila_2:1639932_at:289:85; Interrogation_Position=479; Antisense; AGTGAATATCATCAGCATCCGCCCT
>probe:Drosophila_2:1639932_at:223:533; Interrogation_Position=581; Antisense; GGTGGAGTCTCTGCAAAAGCGCATT
>probe:Drosophila_2:1639932_at:221:107; Interrogation_Position=606; Antisense; AGAAACAGCGTGCACGTTGCTCTAG
>probe:Drosophila_2:1639932_at:112:117; Interrogation_Position=689; Antisense; AGCATCTCTGCTGAAGGGTATCCAA
>probe:Drosophila_2:1639932_at:146:205; Interrogation_Position=712; Antisense; AAGCGGATCTTATCATTACCGGCGA
>probe:Drosophila_2:1639932_at:231:569; Interrogation_Position=732; Antisense; GGCGAAATGTCCCATCACGAAGTTC
>probe:Drosophila_2:1639932_at:560:477; Interrogation_Position=761; Antisense; GTTTACTCACAACAATACCACCGTT
>probe:Drosophila_2:1639932_at:517:129; Interrogation_Position=780; Antisense; ACCGTTCTTCTCTGCAATCATAGTA
>probe:Drosophila_2:1639932_at:386:477; Interrogation_Position=817; Antisense; GTTTTCTCCATGAGTTTTGCCCTAT
>probe:Drosophila_2:1639932_at:67:369; Interrogation_Position=864; Antisense; GAATGCCTGGTATTTGTATCTGAAG
>probe:Drosophila_2:1639932_at:706:557; Interrogation_Position=890; Antisense; GGACAAGGATCCTCTGGTCACCGTG
>probe:Drosophila_2:1639932_at:715:587; Interrogation_Position=904; Antisense; TGGTCACCGTGGCTAGCGATATAAA
>probe:Drosophila_2:1639932_at:229:279; Interrogation_Position=936; Antisense; CTAAGCGCATTTGTTGACGTCTACA

Paste this into a BLAST search page for me
ACAATGCATTTTCTGGCGCATCCATAGTGAATATCATCAGCATCCGCCCTGGTGGAGTCTCTGCAAAAGCGCATTAGAAACAGCGTGCACGTTGCTCTAGAGCATCTCTGCTGAAGGGTATCCAAAAGCGGATCTTATCATTACCGGCGAGGCGAAATGTCCCATCACGAAGTTCGTTTACTCACAACAATACCACCGTTACCGTTCTTCTCTGCAATCATAGTAGTTTTCTCCATGAGTTTTGCCCTATGAATGCCTGGTATTTGTATCTGAAGGGACAAGGATCCTCTGGTCACCGTGTGGTCACCGTGGCTAGCGATATAAACTAAGCGCATTTGTTGACGTCTACA

Full Affymetrix probeset data:

Annotations for 1639932_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720