Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639933_at:

>probe:Drosophila_2:1639933_at:572:457; Interrogation_Position=2049; Antisense; GATAGTCCCAAAGGCAGTTCCCAGT
>probe:Drosophila_2:1639933_at:692:593; Interrogation_Position=2132; Antisense; TGGGCTGGATGCTCCACTATTTGCC
>probe:Drosophila_2:1639933_at:686:687; Interrogation_Position=2149; Antisense; TATTTGCCCTTCTGGGCGATGGGAC
>probe:Drosophila_2:1639933_at:589:117; Interrogation_Position=2166; Antisense; GATGGGACGGGTGCTCTACTTCCAC
>probe:Drosophila_2:1639933_at:492:687; Interrogation_Position=2194; Antisense; TATTTTCCGGCCTTGATCTTCAACT
>probe:Drosophila_2:1639933_at:148:605; Interrogation_Position=2207; Antisense; TGATCTTCAACTCCTTGCTGACGGG
>probe:Drosophila_2:1639933_at:299:335; Interrogation_Position=2223; Antisense; GCTGACGGGCGTTATGTACAACTAC
>probe:Drosophila_2:1639933_at:371:189; Interrogation_Position=2242; Antisense; AACTACATTTTGAGGGTTCTGCCCA
>probe:Drosophila_2:1639933_at:721:227; Interrogation_Position=2267; Antisense; AATGGATTCACCACGTTATCCTCGG
>probe:Drosophila_2:1639933_at:415:705; Interrogation_Position=2282; Antisense; TTATCCTCGGACTGGTTCTCTCGAT
>probe:Drosophila_2:1639933_at:717:45; Interrogation_Position=2305; Antisense; ATCCTGGTGTATAGTTTTGCCGCCT
>probe:Drosophila_2:1639933_at:717:713; Interrogation_Position=2329; Antisense; TTCTCGCCACTTGCTTACGGAATGA
>probe:Drosophila_2:1639933_at:148:645; Interrogation_Position=2396; Antisense; TCAAGTGGCTTTCTACCTGGGAGTT
>probe:Drosophila_2:1639933_at:576:331; Interrogation_Position=2582; Antisense; GCTTAACTCTACGTACTGTTTACAA

Paste this into a BLAST search page for me
GATAGTCCCAAAGGCAGTTCCCAGTTGGGCTGGATGCTCCACTATTTGCCTATTTGCCCTTCTGGGCGATGGGACGATGGGACGGGTGCTCTACTTCCACTATTTTCCGGCCTTGATCTTCAACTTGATCTTCAACTCCTTGCTGACGGGGCTGACGGGCGTTATGTACAACTACAACTACATTTTGAGGGTTCTGCCCAAATGGATTCACCACGTTATCCTCGGTTATCCTCGGACTGGTTCTCTCGATATCCTGGTGTATAGTTTTGCCGCCTTTCTCGCCACTTGCTTACGGAATGATCAAGTGGCTTTCTACCTGGGAGTTGCTTAACTCTACGTACTGTTTACAA

Full Affymetrix probeset data:

Annotations for 1639933_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime