Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639934_at:

>probe:Drosophila_2:1639934_at:32:239; Interrogation_Position=1528; Antisense; AATCTTGCGGGCTCTGGGTCCAAAA
>probe:Drosophila_2:1639934_at:77:579; Interrogation_Position=1565; Antisense; TACGGATTGTTTCTGTCGGGAACCT
>probe:Drosophila_2:1639934_at:403:281; Interrogation_Position=1601; Antisense; CTCTACTTTTCCGTGAGCAGTCTAA
>probe:Drosophila_2:1639934_at:140:515; Interrogation_Position=1637; Antisense; GTGTCTGCGACTTTTCTTACGATTA
>probe:Drosophila_2:1639934_at:633:13; Interrogation_Position=1658; Antisense; ATTACGGGAATTGCTGTCTCTTCAC
>probe:Drosophila_2:1639934_at:84:107; Interrogation_Position=1721; Antisense; AGAACCGTTGTTGTTGCCATTGCCA
>probe:Drosophila_2:1639934_at:232:691; Interrogation_Position=1760; Antisense; TTTGGTGCTCTGTCCGGAAATTTAC
>probe:Drosophila_2:1639934_at:53:173; Interrogation_Position=1803; Antisense; AAACCGGATGTTTGCCACCATTTAT
>probe:Drosophila_2:1639934_at:440:685; Interrogation_Position=1825; Antisense; TATAATGGTGTCCTCAGTGCTGATA
>probe:Drosophila_2:1639934_at:555:621; Interrogation_Position=1842; Antisense; TGCTGATATTATCTGGCATCCTGTC
>probe:Drosophila_2:1639934_at:671:47; Interrogation_Position=1859; Antisense; ATCCTGTCAATATCTCTGCCTGATC
>probe:Drosophila_2:1639934_at:516:603; Interrogation_Position=1879; Antisense; TGATCCGGCAAAGGCAACGTTTTCT
>probe:Drosophila_2:1639934_at:5:551; Interrogation_Position=1953; Antisense; GGAGTGCCCATTTAGAATCGGATCT
>probe:Drosophila_2:1639934_at:430:545; Interrogation_Position=1972; Antisense; GGATCTTGCGACATTAGCTTTTGTT

Paste this into a BLAST search page for me
AATCTTGCGGGCTCTGGGTCCAAAATACGGATTGTTTCTGTCGGGAACCTCTCTACTTTTCCGTGAGCAGTCTAAGTGTCTGCGACTTTTCTTACGATTAATTACGGGAATTGCTGTCTCTTCACAGAACCGTTGTTGTTGCCATTGCCATTTGGTGCTCTGTCCGGAAATTTACAAACCGGATGTTTGCCACCATTTATTATAATGGTGTCCTCAGTGCTGATATGCTGATATTATCTGGCATCCTGTCATCCTGTCAATATCTCTGCCTGATCTGATCCGGCAAAGGCAACGTTTTCTGGAGTGCCCATTTAGAATCGGATCTGGATCTTGCGACATTAGCTTTTGTT

Full Affymetrix probeset data:

Annotations for 1639934_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime