FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639936_at:

>probe:Drosophila_2:1639936_at:291:709; Interrogation_Position=1047; Antisense; TTAAAGTCAGTGAACCCAGCGGCCT
>probe:Drosophila_2:1639936_at:92:285; Interrogation_Position=1070; Antisense; CTGACAGCGGAGGATTTCTTGGACT
>probe:Drosophila_2:1639936_at:681:617; Interrogation_Position=620; Antisense; TGCAGCTTGCAGTTGATATCCGTCT
>probe:Drosophila_2:1639936_at:609:457; Interrogation_Position=634; Antisense; GATATCCGTCTTAAGGACACGCTTT
>probe:Drosophila_2:1639936_at:551:397; Interrogation_Position=649; Antisense; GACACGCTTTCCCAATGTGGCAATT
>probe:Drosophila_2:1639936_at:162:595; Interrogation_Position=664; Antisense; TGTGGCAATTGGGTACTCGGGTCAT
>probe:Drosophila_2:1639936_at:375:529; Interrogation_Position=694; Antisense; GGGAGTGATCATTAGCCAGGCCGCC
>probe:Drosophila_2:1639936_at:579:551; Interrogation_Position=728; Antisense; GGAGCACGCATAGTGGAGCGCCACT
>probe:Drosophila_2:1639936_at:321:417; Interrogation_Position=743; Antisense; GAGCGCCACTTTACGCTGGACAAGA
>probe:Drosophila_2:1639936_at:84:471; Interrogation_Position=857; Antisense; GTTCCCATGCCTCCACAAGAAATAG
>probe:Drosophila_2:1639936_at:44:101; Interrogation_Position=910; Antisense; AGAGGCAGCTCTTCAGCACGTTGAG
>probe:Drosophila_2:1639936_at:38:663; Interrogation_Position=937; Antisense; TAAAACCATTTTGCCGTGCGAGCTG
>probe:Drosophila_2:1639936_at:37:327; Interrogation_Position=954; Antisense; GCGAGCTGCCCTGCCGAAATAAACT
>probe:Drosophila_2:1639936_at:693:643; Interrogation_Position=986; Antisense; TCTATTGTGGCAGCTAGGAATCTCA

Paste this into a BLAST search page for me
TTAAAGTCAGTGAACCCAGCGGCCTCTGACAGCGGAGGATTTCTTGGACTTGCAGCTTGCAGTTGATATCCGTCTGATATCCGTCTTAAGGACACGCTTTGACACGCTTTCCCAATGTGGCAATTTGTGGCAATTGGGTACTCGGGTCATGGGAGTGATCATTAGCCAGGCCGCCGGAGCACGCATAGTGGAGCGCCACTGAGCGCCACTTTACGCTGGACAAGAGTTCCCATGCCTCCACAAGAAATAGAGAGGCAGCTCTTCAGCACGTTGAGTAAAACCATTTTGCCGTGCGAGCTGGCGAGCTGCCCTGCCGAAATAAACTTCTATTGTGGCAGCTAGGAATCTCA

Full Affymetrix probeset data:

Annotations for 1639936_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720