FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639937_at:

>probe:Drosophila_2:1639937_at:25:17; Interrogation_Position=549; Antisense; ATTTTTACATGCTGCCCTTCTATAA
>probe:Drosophila_2:1639937_at:175:477; Interrogation_Position=578; Antisense; GTTTTAGGATTGACCTCCACGCTGA
>probe:Drosophila_2:1639937_at:289:261; Interrogation_Position=595; Antisense; CACGCTGAGTGTTAAGCTGGCCCAG
>probe:Drosophila_2:1639937_at:657:581; Interrogation_Position=612; Antisense; TGGCCCAGGATGATCTGCACATCAT
>probe:Drosophila_2:1639937_at:90:587; Interrogation_Position=645; Antisense; TGGACATACCCACCGGAGATGCAGA
>probe:Drosophila_2:1639937_at:411:527; Interrogation_Position=703; Antisense; GGGACCTTCTGTTTTGATTGTAGAC
>probe:Drosophila_2:1639937_at:72:661; Interrogation_Position=723; Antisense; TAGACGAAGACCATATGTTCCCCGC
>probe:Drosophila_2:1639937_at:241:689; Interrogation_Position=751; Antisense; TATTTGCCAGGCTAGCGATGATCTG
>probe:Drosophila_2:1639937_at:56:445; Interrogation_Position=767; Antisense; GATGATCTGGGCTATGTCAACCTGA
>probe:Drosophila_2:1639937_at:177:311; Interrogation_Position=793; Antisense; GCCAACCTTTGGCTTGAACGTCTAT
>probe:Drosophila_2:1639937_at:306:383; Interrogation_Position=808; Antisense; GAACGTCTATTCTATGCTGAAGCAC
>probe:Drosophila_2:1639937_at:18:667; Interrogation_Position=835; Antisense; TACTTTGGTGCTGACAGTGGCTGCA
>probe:Drosophila_2:1639937_at:135:315; Interrogation_Position=879; Antisense; GCCTGCTCTACCAACTTAATCGAAA
>probe:Drosophila_2:1639937_at:705:691; Interrogation_Position=979; Antisense; TTTGTAACCTTTATGGATGCGCCAG

Paste this into a BLAST search page for me
ATTTTTACATGCTGCCCTTCTATAAGTTTTAGGATTGACCTCCACGCTGACACGCTGAGTGTTAAGCTGGCCCAGTGGCCCAGGATGATCTGCACATCATTGGACATACCCACCGGAGATGCAGAGGGACCTTCTGTTTTGATTGTAGACTAGACGAAGACCATATGTTCCCCGCTATTTGCCAGGCTAGCGATGATCTGGATGATCTGGGCTATGTCAACCTGAGCCAACCTTTGGCTTGAACGTCTATGAACGTCTATTCTATGCTGAAGCACTACTTTGGTGCTGACAGTGGCTGCAGCCTGCTCTACCAACTTAATCGAAATTTGTAACCTTTATGGATGCGCCAG

Full Affymetrix probeset data:

Annotations for 1639937_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720