Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639940_at:

>probe:Drosophila_2:1639940_at:33:483; Interrogation_Position=2644; Antisense; GTATAGTATTCAATCCGTTCCTCAG
>probe:Drosophila_2:1639940_at:532:233; Interrogation_Position=2655; Antisense; AATCCGTTCCTCAGTGTGAATGTGC
>probe:Drosophila_2:1639940_at:153:631; Interrogation_Position=2662; Antisense; TCCTCAGTGTGAATGTGCAGATGCA
>probe:Drosophila_2:1639940_at:376:525; Interrogation_Position=2716; Antisense; GGGATCCCAGGATCGGATCCAAAAA
>probe:Drosophila_2:1639940_at:459:213; Interrogation_Position=2754; Antisense; AAGTCTGTCATCTGAAAAGCGGGCT
>probe:Drosophila_2:1639940_at:646:277; Interrogation_Position=2758; Antisense; CTGTCATCTGAAAAGCGGGCTGGGC
>probe:Drosophila_2:1639940_at:632:299; Interrogation_Position=2825; Antisense; CCCCTCTATCGGTGTACAACGAAGT
>probe:Drosophila_2:1639940_at:266:483; Interrogation_Position=2943; Antisense; GTATAACTTGGATGTACTAACACAG
>probe:Drosophila_2:1639940_at:626:547; Interrogation_Position=2952; Antisense; GGATGTACTAACACAGCAAGCAAAT
>probe:Drosophila_2:1639940_at:182:127; Interrogation_Position=3019; Antisense; ACCAGAAGAGATTCAATTCAACCAA
>probe:Drosophila_2:1639940_at:46:235; Interrogation_Position=3093; Antisense; AATCCATCGCAAAGGTTGATAGATC
>probe:Drosophila_2:1639940_at:605:387; Interrogation_Position=3128; Antisense; GAAAATGTTATTGCTATCGCAAACG
>probe:Drosophila_2:1639940_at:619:129; Interrogation_Position=3150; Antisense; ACGAAAATTCCTCCCGACGATTGTG
>probe:Drosophila_2:1639940_at:534:281; Interrogation_Position=3160; Antisense; CTCCCGACGATTGTGTACTGTATTA

Paste this into a BLAST search page for me
GTATAGTATTCAATCCGTTCCTCAGAATCCGTTCCTCAGTGTGAATGTGCTCCTCAGTGTGAATGTGCAGATGCAGGGATCCCAGGATCGGATCCAAAAAAAGTCTGTCATCTGAAAAGCGGGCTCTGTCATCTGAAAAGCGGGCTGGGCCCCCTCTATCGGTGTACAACGAAGTGTATAACTTGGATGTACTAACACAGGGATGTACTAACACAGCAAGCAAATACCAGAAGAGATTCAATTCAACCAAAATCCATCGCAAAGGTTGATAGATCGAAAATGTTATTGCTATCGCAAACGACGAAAATTCCTCCCGACGATTGTGCTCCCGACGATTGTGTACTGTATTA

Full Affymetrix probeset data:

Annotations for 1639940_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime